Mutagenetix > Incidental Mutations

Incidental Mutation 'R6381:Supt16'

515335

Institutional Source

Beutler Lab

Gene Symbol

Supt16

Ensembl Gene

ENSMUSG00000035726

Gene Name

suppressor of Ty 16

Synonyms

Supt16h, Spt16, Fact140, Cdc68

MMRRC Submission

Accession Numbers

Is this an essential gene?

Probably essential (E-score: 0.968) question?

Stock #

R6381 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

52160414-52197416 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 52179546 bp

Zygosity

Heterozygous

Amino Acid Change

Valine to Alanine at position 325 (V325A)

Ref Sequence

ENSEMBL: ENSMUSP00000042283 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000046709]

Predicted Effect

probably benign
Transcript: ENSMUST00000046709
AA Change: V325A

PolyPhen 2 Score 0.016 (Sensitivity: 0.95; Specificity: 0.79)

SMART Domains

Protein: ENSMUSP00000042283
Gene: ENSMUSG00000035726
AA Change: V325A

Domain	Start	End	E-Value	Type
FACT-Spt16_Nlob	5	168	2.95e-87	SMART
Pfam:Peptidase_M24	181	411	2.9e-35	PFAM
low complexity region	435	449	N/A	INTRINSIC
coiled coil region	462	493	N/A	INTRINSIC
SPT16	529	689	3.38e-96	SMART
Rtt106	806	896	1.61e-38	SMART
low complexity region	926	946	N/A	INTRINSIC
low complexity region	951	988	N/A	INTRINSIC
coiled coil region	994	1023	N/A	INTRINSIC

Meta Mutation Damage Score

0.1313

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.2%
20x: 97.2%

Validation Efficiency

97% (56/58)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Transcription of protein-coding genes can be reconstituted on naked DNA with only the general transcription factors and RNA polymerase II. However, this minimal system cannot transcribe DNA packaged into chromatin, indicating that accessory factors may facilitate access to DNA. One such factor, FACT (facilitates chromatin transcription), interacts specifically with histones H2A/H2B to effect nucleosome disassembly and transcription elongation. FACT is composed of an 80 kDa subunit and a 140 kDa subunit; this gene encodes the 140 kDa subunit. [provided by RefSeq, Feb 2009]

Allele List at MGI

Other mutations in this stock

Total: 56 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4930503L19Rik	T	A	18: 70,467,717	M365L	probably damaging	Het
5330417C22Rik	T	C	3: 108,481,814	K222E	possibly damaging	Het
Aars2	A	G	17: 45,518,545	E786G	probably benign	Het
Adamts12	G	T	15: 11,256,994	V478F	possibly damaging	Het
Akr1c21	T	A	13: 4,574,184	D12E	probably damaging	Het
Aplf	A	T	6: 87,658,977	M118K	probably damaging	Het
Apobec1	A	G	6: 122,578,931	L189P	probably damaging	Het
BC061237	A	G	14: 44,504,256	Q152R	possibly damaging	Het
Bche	A	G	3: 73,701,799	I98T	probably benign	Het
Cc2d2a	G	T	5: 43,715,776	R983L	possibly damaging	Het
Ccnd3	T	C	17: 47,505,224		probably benign	Het
Cd74	G	T	18: 60,811,363	C215F	probably damaging	Het
Cep97	C	T	16: 55,922,171	A138T	probably damaging	Het
Ces1e	T	A	8: 93,217,578	N204I	probably damaging	Het
Dicer1	T	C	12: 104,696,462	D1620G	probably benign	Het
Dnah17	A	G	11: 118,129,185	V12A	probably benign	Het
Dstyk	T	A	1: 132,456,765		probably null	Het
Eml2	G	A	7: 19,201,163	V432I	probably damaging	Het
Gm10570	G	T	4: 130,308,228		probably benign	Het
Gm7145	C	T	1: 117,985,939	Q184*	probably null	Het
Gpat2	G	C	2: 127,431,918	G294R	possibly damaging	Het
Gtse1	G	A	15: 85,862,148	R55H	probably benign	Het
Hdac4	G	T	1: 91,984,525	Q381K	possibly damaging	Het
Ifit3b	T	C	19: 34,612,471	I349T	probably benign	Het
Inpp5a	A	T	7: 139,400,673	D9V	probably benign	Het
Irs1	T	C	1: 82,287,684	N937S	possibly damaging	Het
Kcna4	T	C	2: 107,294,972	M17T	probably benign	Het
Lipa	T	A	19: 34,524,746	M33L	probably benign	Het
March6	G	T	15: 31,467,692	Q790K	probably benign	Het
Mccc1	G	A	3: 35,976,727	P397S	probably benign	Het
Mrgprb2	T	C	7: 48,552,390	I196V	probably benign	Het
Myh15	T	A	16: 49,101,481	S463R	probably damaging	Het
Nab2	T	C	10: 127,664,351	K291E	probably damaging	Het
Neto2	T	C	8: 85,642,509	T294A	probably damaging	Het
Nkx1-1	T	C	5: 33,433,976	M1V	probably null	Het
Olfr90	C	T	17: 37,086,085	V27I	probably benign	Het
Pla2g4c	C	T	7: 13,344,008	T357I	probably benign	Het
Psmd2	A	G	16: 20,655,273	E242G	probably benign	Het
Rnase12	A	C	14: 51,057,094	Y43D	probably damaging	Het
Rpl18	T	A	7: 45,719,592	F58I	probably damaging	Het
Ryr1	T	G	7: 29,075,257	M2313L	possibly damaging	Het
Scn4a	G	T	11: 106,320,311	Q1627K	probably damaging	Het
Scnn1g	A	G	7: 121,767,499	S640G	probably benign	Het
Sdccag3	A	G	2: 26,385,081		probably null	Het
Sdr9c7	T	A	10: 127,903,673	M219K	probably benign	Het
Soat1	A	T	1: 156,435,803	M392K	probably damaging	Het
Spata18	G	T	5: 73,675,216	K337N	probably damaging	Het
Syt2	A	G	1: 134,746,850	E342G	probably damaging	Het
Tars2	A	T	3: 95,754,487	L37*	probably null	Het
Tep1	T	C	14: 50,845,431	D1040G	probably damaging	Het
Tmc8	A	T	11: 117,791,600	S613C	probably null	Het
Top3a	C	T	11: 60,744,023	C660Y	probably damaging	Het
Tpsg1	C	T	17: 25,372,569	R48C	probably damaging	Het
Vmn2r57	T	C	7: 41,428,818	N72S	probably benign	Het
Whrn	G	A	4: 63,472,684	T269I	probably benign	Het
Zfp759	T	A	13: 67,138,905	Y173*	probably null	Het

Other mutations in Supt16

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00950:Supt16	APN	14	52161798	missense	possibly damaging	0.72
IGL00985:Supt16	APN	14	52161691	missense	possibly damaging	0.53
IGL01160:Supt16	APN	14	52183132	missense	probably benign
IGL01328:Supt16	APN	14	52177032	missense	probably benign	0.20
IGL01329:Supt16	APN	14	52177032	missense	probably benign	0.20
IGL01413:Supt16	APN	14	52177032	missense	probably benign	0.20
IGL01414:Supt16	APN	14	52177032	missense	probably benign	0.20
IGL01535:Supt16	APN	14	52177190	missense	probably damaging	0.99
IGL01765:Supt16	APN	14	52180223	missense	probably damaging	0.98
IGL01976:Supt16	APN	14	52182307	missense	possibly damaging	0.70
IGL02422:Supt16	APN	14	52179543	missense	possibly damaging	0.85
IGL02449:Supt16	APN	14	52173806	missense	possibly damaging	0.92
IGL02516:Supt16	APN	14	52183964	missense	possibly damaging	0.57
IGL02831:Supt16	APN	14	52170878	missense	possibly damaging	0.70
IGL03112:Supt16	APN	14	52176398	missense	probably damaging	0.98
IGL03406:Supt16	APN	14	52178141	missense	possibly damaging	0.92
watercolor	UTSW	14	52170881	missense	probably damaging	0.96
R0332:Supt16	UTSW	14	52181157	missense	probably damaging	0.99
R0385:Supt16	UTSW	14	52176718	missense	probably benign	0.01
R0389:Supt16	UTSW	14	52174113	missense	probably damaging	0.98
R0422:Supt16	UTSW	14	52183996	missense	probably benign	0.26
R1101:Supt16	UTSW	14	52171439	missense	probably null	0.81
R1212:Supt16	UTSW	14	52174124	nonsense	probably null
R1487:Supt16	UTSW	14	52176608	critical splice donor site	probably null
R1494:Supt16	UTSW	14	52172459	missense	probably benign	0.01
R1566:Supt16	UTSW	14	52176655	missense	probably damaging	0.99
R1652:Supt16	UTSW	14	52177180	missense	probably benign	0.34
R1913:Supt16	UTSW	14	52178135	missense	possibly damaging	0.84
R2220:Supt16	UTSW	14	52172144	nonsense	probably null
R2344:Supt16	UTSW	14	52178118	missense	probably benign	0.00
R3430:Supt16	UTSW	14	52175359	missense	probably benign	0.05
R3746:Supt16	UTSW	14	52180139	missense	probably damaging	0.99
R3749:Supt16	UTSW	14	52180139	missense	probably damaging	0.99
R4010:Supt16	UTSW	14	52164441	missense	probably damaging	1.00
R4108:Supt16	UTSW	14	52162731	missense	probably damaging	1.00
R4109:Supt16	UTSW	14	52162731	missense	probably damaging	1.00
R4597:Supt16	UTSW	14	52173589	missense	probably damaging	1.00
R5117:Supt16	UTSW	14	52183092	missense	probably damaging	1.00
R5309:Supt16	UTSW	14	52162698	missense	probably damaging	1.00
R5695:Supt16	UTSW	14	52174144	splice site	probably null
R5895:Supt16	UTSW	14	52164522	missense	probably benign	0.17
R5941:Supt16	UTSW	14	52182196	missense	probably benign
R5993:Supt16	UTSW	14	52178334	missense	probably damaging	1.00
R6197:Supt16	UTSW	14	52170881	missense	probably damaging	0.96
R6254:Supt16	UTSW	14	52170834	missense	probably damaging	1.00
R6667:Supt16	UTSW	14	52172063	missense	probably damaging	1.00
R7000:Supt16	UTSW	14	52171450	missense	probably damaging	0.97
R7063:Supt16	UTSW	14	52172048	missense	possibly damaging	0.92
R7276:Supt16	UTSW	14	52177001	missense	probably benign
R7336:Supt16	UTSW	14	52171491	missense	possibly damaging	0.93
R7344:Supt16	UTSW	14	52173571	missense	probably damaging	0.98
R7384:Supt16	UTSW	14	52181162	missense	probably damaging	0.99
R7411:Supt16	UTSW	14	52178051	missense	probably damaging	1.00
R7586:Supt16	UTSW	14	52173556	missense	probably damaging	0.97
R7633:Supt16	UTSW	14	52197099	missense	probably benign	0.38
R8024:Supt16	UTSW	14	52170875	missense	probably damaging	0.96
R8197:Supt16	UTSW	14	52174085	missense	possibly damaging	0.95
R8201:Supt16	UTSW	14	52170990	missense	probably damaging	1.00
R8285:Supt16	UTSW	14	52181083	missense	possibly damaging	0.95
R8508:Supt16	UTSW	14	52181589	missense	probably damaging	1.00
R8531:Supt16	UTSW	14	52172563	missense	probably damaging	0.98
Z1177:Supt16	UTSW	14	52163285	missense	possibly damaging	0.63
Z1177:Supt16	UTSW	14	52181537	missense	probably null	0.21

Predicted Primers

PCR Primer
(F):5'- CAAACTTGTACTACAAAATACTGGTGG -3'
(R):5'- CGGTCTTCGATACCACAAAAG -3'

Sequencing Primer
(F):5'- CCGGTAACCTCTGTACTTGGGAAG -3'
(R):5'- CTGGAACTCACTTTGTAGACCAGG -3'

Posted On

2018-05-04