Incidental Mutation 'R6381:Supt16'
ID 515335
Institutional Source Beutler Lab
Gene Symbol Supt16
Ensembl Gene ENSMUSG00000035726
Gene Name SPT16, facilitates chromatin remodeling subunit
Synonyms Spt16, Fact140, Supt16h, Cdc68
MMRRC Submission 044530-MU
Accession Numbers
Essential gene? Probably essential (E-score: 0.968) question?
Stock # R6381 (G1)
Quality Score 225.009
Status Validated
Chromosome 14
Chromosomal Location 52397876-52434696 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 52417003 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Valine to Alanine at position 325 (V325A)
Ref Sequence ENSEMBL: ENSMUSP00000042283 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000046709]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000046709
AA Change: V325A

PolyPhen 2 Score 0.016 (Sensitivity: 0.95; Specificity: 0.79)
SMART Domains Protein: ENSMUSP00000042283
Gene: ENSMUSG00000035726
AA Change: V325A

DomainStartEndE-ValueType
FACT-Spt16_Nlob 5 168 2.95e-87 SMART
Pfam:Peptidase_M24 181 411 2.9e-35 PFAM
low complexity region 435 449 N/A INTRINSIC
coiled coil region 462 493 N/A INTRINSIC
SPT16 529 689 3.38e-96 SMART
Rtt106 806 896 1.61e-38 SMART
low complexity region 926 946 N/A INTRINSIC
low complexity region 951 988 N/A INTRINSIC
coiled coil region 994 1023 N/A INTRINSIC
Meta Mutation Damage Score 0.1313 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.2%
  • 20x: 97.2%
Validation Efficiency 97% (56/58)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Transcription of protein-coding genes can be reconstituted on naked DNA with only the general transcription factors and RNA polymerase II. However, this minimal system cannot transcribe DNA packaged into chromatin, indicating that accessory factors may facilitate access to DNA. One such factor, FACT (facilitates chromatin transcription), interacts specifically with histones H2A/H2B to effect nucleosome disassembly and transcription elongation. FACT is composed of an 80 kDa subunit and a 140 kDa subunit; this gene encodes the 140 kDa subunit. [provided by RefSeq, Feb 2009]
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930503L19Rik T A 18: 70,600,788 (GRCm39) M365L probably damaging Het
Aars2 A G 17: 45,829,471 (GRCm39) E786G probably benign Het
Adamts12 G T 15: 11,257,080 (GRCm39) V478F possibly damaging Het
Akr1c21 T A 13: 4,624,183 (GRCm39) D12E probably damaging Het
Aplf A T 6: 87,635,959 (GRCm39) M118K probably damaging Het
Apobec1 A G 6: 122,555,890 (GRCm39) L189P probably damaging Het
BC061237 A G 14: 44,741,713 (GRCm39) Q152R possibly damaging Het
Bche A G 3: 73,609,132 (GRCm39) I98T probably benign Het
Cc2d2a G T 5: 43,873,118 (GRCm39) R983L possibly damaging Het
Ccnd3 T C 17: 47,816,149 (GRCm39) probably benign Het
Cd74 G T 18: 60,944,435 (GRCm39) C215F probably damaging Het
Cep97 C T 16: 55,742,534 (GRCm39) A138T probably damaging Het
Ces1e T A 8: 93,944,206 (GRCm39) N204I probably damaging Het
Dicer1 T C 12: 104,662,721 (GRCm39) D1620G probably benign Het
Dnah17 A G 11: 118,020,011 (GRCm39) V12A probably benign Het
Dstyk T A 1: 132,384,503 (GRCm39) probably null Het
Elapor1 T C 3: 108,389,130 (GRCm39) K222E possibly damaging Het
Eml2 G A 7: 18,935,088 (GRCm39) V432I probably damaging Het
Entr1 A G 2: 26,275,093 (GRCm39) probably null Het
Gm10570 G T 4: 130,202,021 (GRCm39) probably benign Het
Gm7145 C T 1: 117,913,669 (GRCm39) Q184* probably null Het
Gpat2 G C 2: 127,273,838 (GRCm39) G294R possibly damaging Het
Gtse1 G A 15: 85,746,349 (GRCm39) R55H probably benign Het
Hdac4 G T 1: 91,912,247 (GRCm39) Q381K possibly damaging Het
Ifit3b T C 19: 34,589,871 (GRCm39) I349T probably benign Het
Inpp5a A T 7: 138,980,589 (GRCm39) D9V probably benign Het
Irs1 T C 1: 82,265,405 (GRCm39) N937S possibly damaging Het
Kcna4 T C 2: 107,125,317 (GRCm39) M17T probably benign Het
Lipa T A 19: 34,502,146 (GRCm39) M33L probably benign Het
Marchf6 G T 15: 31,467,838 (GRCm39) Q790K probably benign Het
Mccc1 G A 3: 36,030,876 (GRCm39) P397S probably benign Het
Mrgprb2 T C 7: 48,202,138 (GRCm39) I196V probably benign Het
Myh15 T A 16: 48,921,844 (GRCm39) S463R probably damaging Het
Nab2 T C 10: 127,500,220 (GRCm39) K291E probably damaging Het
Neto2 T C 8: 86,369,138 (GRCm39) T294A probably damaging Het
Nkx1-1 T C 5: 33,591,320 (GRCm39) M1V probably null Het
Or2h2 C T 17: 37,396,977 (GRCm39) V27I probably benign Het
Pla2g4c C T 7: 13,077,933 (GRCm39) T357I probably benign Het
Psmd2 A G 16: 20,474,023 (GRCm39) E242G probably benign Het
Rnase12 A C 14: 51,294,551 (GRCm39) Y43D probably damaging Het
Rpl18 T A 7: 45,369,016 (GRCm39) F58I probably damaging Het
Ryr1 T G 7: 28,774,682 (GRCm39) M2313L possibly damaging Het
Scn4a G T 11: 106,211,137 (GRCm39) Q1627K probably damaging Het
Scnn1g A G 7: 121,366,722 (GRCm39) S640G probably benign Het
Sdr9c7 T A 10: 127,739,542 (GRCm39) M219K probably benign Het
Soat1 A T 1: 156,263,373 (GRCm39) M392K probably damaging Het
Spata18 G T 5: 73,832,559 (GRCm39) K337N probably damaging Het
Syt2 A G 1: 134,674,588 (GRCm39) E342G probably damaging Het
Tars2 A T 3: 95,661,799 (GRCm39) L37* probably null Het
Tep1 T C 14: 51,082,888 (GRCm39) D1040G probably damaging Het
Tmc8 A T 11: 117,682,426 (GRCm39) S613C probably null Het
Top3a C T 11: 60,634,849 (GRCm39) C660Y probably damaging Het
Tpsg1 C T 17: 25,591,543 (GRCm39) R48C probably damaging Het
Vmn2r57 T C 7: 41,078,242 (GRCm39) N72S probably benign Het
Whrn G A 4: 63,390,921 (GRCm39) T269I probably benign Het
Zfp759 T A 13: 67,286,969 (GRCm39) Y173* probably null Het
Other mutations in Supt16
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00950:Supt16 APN 14 52,399,255 (GRCm39) missense possibly damaging 0.72
IGL00985:Supt16 APN 14 52,399,148 (GRCm39) missense possibly damaging 0.53
IGL01160:Supt16 APN 14 52,420,589 (GRCm39) missense probably benign
IGL01328:Supt16 APN 14 52,414,489 (GRCm39) missense probably benign 0.20
IGL01329:Supt16 APN 14 52,414,489 (GRCm39) missense probably benign 0.20
IGL01413:Supt16 APN 14 52,414,489 (GRCm39) missense probably benign 0.20
IGL01414:Supt16 APN 14 52,414,489 (GRCm39) missense probably benign 0.20
IGL01535:Supt16 APN 14 52,414,647 (GRCm39) missense probably damaging 0.99
IGL01765:Supt16 APN 14 52,417,680 (GRCm39) missense probably damaging 0.98
IGL01976:Supt16 APN 14 52,419,764 (GRCm39) missense possibly damaging 0.70
IGL02422:Supt16 APN 14 52,417,000 (GRCm39) missense possibly damaging 0.85
IGL02449:Supt16 APN 14 52,411,263 (GRCm39) missense possibly damaging 0.92
IGL02516:Supt16 APN 14 52,421,421 (GRCm39) missense possibly damaging 0.57
IGL02831:Supt16 APN 14 52,408,335 (GRCm39) missense possibly damaging 0.70
IGL03112:Supt16 APN 14 52,413,855 (GRCm39) missense probably damaging 0.98
IGL03406:Supt16 APN 14 52,415,598 (GRCm39) missense possibly damaging 0.92
R7336_Supt16_529 UTSW 14 52,408,948 (GRCm39) missense possibly damaging 0.93
watercolor UTSW 14 52,408,338 (GRCm39) missense probably damaging 0.96
R0332:Supt16 UTSW 14 52,418,614 (GRCm39) missense probably damaging 0.99
R0385:Supt16 UTSW 14 52,414,175 (GRCm39) missense probably benign 0.01
R0389:Supt16 UTSW 14 52,411,570 (GRCm39) missense probably damaging 0.98
R0422:Supt16 UTSW 14 52,421,453 (GRCm39) missense probably benign 0.26
R1101:Supt16 UTSW 14 52,408,896 (GRCm39) missense probably null 0.81
R1212:Supt16 UTSW 14 52,411,581 (GRCm39) nonsense probably null
R1487:Supt16 UTSW 14 52,414,065 (GRCm39) critical splice donor site probably null
R1494:Supt16 UTSW 14 52,409,916 (GRCm39) missense probably benign 0.01
R1566:Supt16 UTSW 14 52,414,112 (GRCm39) missense probably damaging 0.99
R1652:Supt16 UTSW 14 52,414,637 (GRCm39) missense probably benign 0.34
R1913:Supt16 UTSW 14 52,415,592 (GRCm39) missense possibly damaging 0.84
R2220:Supt16 UTSW 14 52,409,601 (GRCm39) nonsense probably null
R2344:Supt16 UTSW 14 52,415,575 (GRCm39) missense probably benign 0.00
R3430:Supt16 UTSW 14 52,412,816 (GRCm39) missense probably benign 0.05
R3746:Supt16 UTSW 14 52,417,596 (GRCm39) missense probably damaging 0.99
R3749:Supt16 UTSW 14 52,417,596 (GRCm39) missense probably damaging 0.99
R4010:Supt16 UTSW 14 52,401,898 (GRCm39) missense probably damaging 1.00
R4108:Supt16 UTSW 14 52,400,188 (GRCm39) missense probably damaging 1.00
R4109:Supt16 UTSW 14 52,400,188 (GRCm39) missense probably damaging 1.00
R4597:Supt16 UTSW 14 52,411,046 (GRCm39) missense probably damaging 1.00
R5117:Supt16 UTSW 14 52,420,549 (GRCm39) missense probably damaging 1.00
R5309:Supt16 UTSW 14 52,400,155 (GRCm39) missense probably damaging 1.00
R5695:Supt16 UTSW 14 52,411,601 (GRCm39) splice site probably null
R5895:Supt16 UTSW 14 52,401,979 (GRCm39) missense probably benign 0.17
R5941:Supt16 UTSW 14 52,419,653 (GRCm39) missense probably benign
R5993:Supt16 UTSW 14 52,415,791 (GRCm39) missense probably damaging 1.00
R6197:Supt16 UTSW 14 52,408,338 (GRCm39) missense probably damaging 0.96
R6254:Supt16 UTSW 14 52,408,291 (GRCm39) missense probably damaging 1.00
R6667:Supt16 UTSW 14 52,409,520 (GRCm39) missense probably damaging 1.00
R7000:Supt16 UTSW 14 52,408,907 (GRCm39) missense probably damaging 0.97
R7063:Supt16 UTSW 14 52,409,505 (GRCm39) missense possibly damaging 0.92
R7276:Supt16 UTSW 14 52,414,458 (GRCm39) missense probably benign
R7336:Supt16 UTSW 14 52,408,948 (GRCm39) missense possibly damaging 0.93
R7344:Supt16 UTSW 14 52,411,028 (GRCm39) missense probably damaging 0.98
R7384:Supt16 UTSW 14 52,418,619 (GRCm39) missense probably damaging 0.99
R7411:Supt16 UTSW 14 52,415,508 (GRCm39) missense probably damaging 1.00
R7586:Supt16 UTSW 14 52,411,013 (GRCm39) missense probably damaging 0.97
R7633:Supt16 UTSW 14 52,434,556 (GRCm39) missense probably benign 0.38
R8024:Supt16 UTSW 14 52,408,332 (GRCm39) missense probably damaging 0.96
R8197:Supt16 UTSW 14 52,411,542 (GRCm39) missense possibly damaging 0.95
R8201:Supt16 UTSW 14 52,408,447 (GRCm39) missense probably damaging 1.00
R8285:Supt16 UTSW 14 52,418,540 (GRCm39) missense possibly damaging 0.95
R8508:Supt16 UTSW 14 52,419,046 (GRCm39) missense probably damaging 1.00
R8531:Supt16 UTSW 14 52,410,020 (GRCm39) missense probably damaging 0.98
R8797:Supt16 UTSW 14 52,409,960 (GRCm39) missense probably damaging 0.99
R8872:Supt16 UTSW 14 52,411,544 (GRCm39) missense probably benign 0.01
R9048:Supt16 UTSW 14 52,418,513 (GRCm39) missense probably damaging 1.00
R9743:Supt16 UTSW 14 52,408,939 (GRCm39) missense probably damaging 1.00
Z1177:Supt16 UTSW 14 52,418,994 (GRCm39) missense probably null 0.21
Z1177:Supt16 UTSW 14 52,400,742 (GRCm39) missense possibly damaging 0.63
Predicted Primers PCR Primer
(F):5'- CAAACTTGTACTACAAAATACTGGTGG -3'
(R):5'- CGGTCTTCGATACCACAAAAG -3'

Sequencing Primer
(F):5'- CCGGTAACCTCTGTACTTGGGAAG -3'
(R):5'- CTGGAACTCACTTTGTAGACCAGG -3'
Posted On 2018-05-04