Incidental Mutation 'R6381:Gtse1'
ID 515338
Institutional Source Beutler Lab
Gene Symbol Gtse1
Ensembl Gene ENSMUSG00000022385
Gene Name G two S phase expressed protein 1
Synonyms B99, Gtse-1
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.064) question?
Stock # R6381 (G1)
Quality Score 225.009
Status Validated
Chromosome 15
Chromosomal Location 85859745-85876573 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) G to A at 85862148 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Arginine to Histidine at position 55 (R55H)
Ref Sequence ENSEMBL: ENSMUSP00000155552 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000146088] [ENSMUST00000170629] [ENSMUST00000231074]
AlphaFold Q8R080
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133158
Predicted Effect probably benign
Transcript: ENSMUST00000146088
SMART Domains Protein: ENSMUSP00000114504
Gene: ENSMUSG00000035944

DomainStartEndE-ValueType
SCOP:d1ld8a_ 105 272 1e-7 SMART
low complexity region 342 354 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000170629
AA Change: R55H

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000128759
Gene: ENSMUSG00000022385
AA Change: R55H

DomainStartEndE-ValueType
Pfam:GTSE1_N 10 153 3e-62 PFAM
low complexity region 284 301 N/A INTRINSIC
low complexity region 310 321 N/A INTRINSIC
low complexity region 360 372 N/A INTRINSIC
low complexity region 478 497 N/A INTRINSIC
low complexity region 568 593 N/A INTRINSIC
low complexity region 644 653 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000231074
AA Change: R55H

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.2%
  • 20x: 97.2%
Validation Efficiency 97% (56/58)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is only expressed in the S and G2 phases of the cell cycle, where it colocalizes with cytoplasmic tubulin and microtubules. In response to DNA damage, the encoded protein accumulates in the nucleus and binds the tumor suppressor protein p53, shuttling it out of the nucleus and repressing its ability to induce apoptosis. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930503L19Rik T A 18: 70,467,717 M365L probably damaging Het
5330417C22Rik T C 3: 108,481,814 K222E possibly damaging Het
Aars2 A G 17: 45,518,545 E786G probably benign Het
Adamts12 G T 15: 11,256,994 V478F possibly damaging Het
Akr1c21 T A 13: 4,574,184 D12E probably damaging Het
Aplf A T 6: 87,658,977 M118K probably damaging Het
Apobec1 A G 6: 122,578,931 L189P probably damaging Het
BC061237 A G 14: 44,504,256 Q152R possibly damaging Het
Bche A G 3: 73,701,799 I98T probably benign Het
Cc2d2a G T 5: 43,715,776 R983L possibly damaging Het
Ccnd3 T C 17: 47,505,224 probably benign Het
Cd74 G T 18: 60,811,363 C215F probably damaging Het
Cep97 C T 16: 55,922,171 A138T probably damaging Het
Ces1e T A 8: 93,217,578 N204I probably damaging Het
Dicer1 T C 12: 104,696,462 D1620G probably benign Het
Dnah17 A G 11: 118,129,185 V12A probably benign Het
Dstyk T A 1: 132,456,765 probably null Het
Eml2 G A 7: 19,201,163 V432I probably damaging Het
Gm10570 G T 4: 130,308,228 probably benign Het
Gm7145 C T 1: 117,985,939 Q184* probably null Het
Gpat2 G C 2: 127,431,918 G294R possibly damaging Het
Hdac4 G T 1: 91,984,525 Q381K possibly damaging Het
Ifit3b T C 19: 34,612,471 I349T probably benign Het
Inpp5a A T 7: 139,400,673 D9V probably benign Het
Irs1 T C 1: 82,287,684 N937S possibly damaging Het
Kcna4 T C 2: 107,294,972 M17T probably benign Het
Lipa T A 19: 34,524,746 M33L probably benign Het
March6 G T 15: 31,467,692 Q790K probably benign Het
Mccc1 G A 3: 35,976,727 P397S probably benign Het
Mrgprb2 T C 7: 48,552,390 I196V probably benign Het
Myh15 T A 16: 49,101,481 S463R probably damaging Het
Nab2 T C 10: 127,664,351 K291E probably damaging Het
Neto2 T C 8: 85,642,509 T294A probably damaging Het
Nkx1-1 T C 5: 33,433,976 M1V probably null Het
Olfr90 C T 17: 37,086,085 V27I probably benign Het
Pla2g4c C T 7: 13,344,008 T357I probably benign Het
Psmd2 A G 16: 20,655,273 E242G probably benign Het
Rnase12 A C 14: 51,057,094 Y43D probably damaging Het
Rpl18 T A 7: 45,719,592 F58I probably damaging Het
Ryr1 T G 7: 29,075,257 M2313L possibly damaging Het
Scn4a G T 11: 106,320,311 Q1627K probably damaging Het
Scnn1g A G 7: 121,767,499 S640G probably benign Het
Sdccag3 A G 2: 26,385,081 probably null Het
Sdr9c7 T A 10: 127,903,673 M219K probably benign Het
Soat1 A T 1: 156,435,803 M392K probably damaging Het
Spata18 G T 5: 73,675,216 K337N probably damaging Het
Supt16 A G 14: 52,179,546 V325A probably benign Het
Syt2 A G 1: 134,746,850 E342G probably damaging Het
Tars2 A T 3: 95,754,487 L37* probably null Het
Tep1 T C 14: 50,845,431 D1040G probably damaging Het
Tmc8 A T 11: 117,791,600 S613C probably null Het
Top3a C T 11: 60,744,023 C660Y probably damaging Het
Tpsg1 C T 17: 25,372,569 R48C probably damaging Het
Vmn2r57 T C 7: 41,428,818 N72S probably benign Het
Whrn G A 4: 63,472,684 T269I probably benign Het
Zfp759 T A 13: 67,138,905 Y173* probably null Het
Other mutations in Gtse1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00990:Gtse1 APN 15 85868817 missense possibly damaging 0.54
IGL01344:Gtse1 APN 15 85862066 critical splice acceptor site probably null
IGL01541:Gtse1 APN 15 85875654 nonsense probably null
IGL01621:Gtse1 APN 15 85875082 missense probably benign 0.01
IGL01945:Gtse1 APN 15 85871547 missense probably benign 0.00
IGL02193:Gtse1 APN 15 85862330 missense probably benign 0.27
IGL02215:Gtse1 APN 15 85862598 missense possibly damaging 0.92
IGL02494:Gtse1 APN 15 85867503 missense probably damaging 1.00
IGL02879:Gtse1 APN 15 85869063 splice site probably benign
R0009:Gtse1 UTSW 15 85862435 missense probably benign 0.06
R0047:Gtse1 UTSW 15 85862378 missense probably damaging 1.00
R0047:Gtse1 UTSW 15 85862378 missense probably damaging 1.00
R0576:Gtse1 UTSW 15 85869051 missense probably damaging 1.00
R1078:Gtse1 UTSW 15 85862307 missense probably damaging 0.98
R1442:Gtse1 UTSW 15 85860102 splice site probably benign
R1623:Gtse1 UTSW 15 85867578 missense probably benign
R1925:Gtse1 UTSW 15 85873738 missense probably benign 0.00
R1928:Gtse1 UTSW 15 85862063 splice site probably benign
R4565:Gtse1 UTSW 15 85875184 missense probably damaging 0.99
R5170:Gtse1 UTSW 15 85864264 critical splice donor site probably null
R5310:Gtse1 UTSW 15 85873792 missense probably benign 0.04
R5428:Gtse1 UTSW 15 85862139 missense probably benign 0.12
R5748:Gtse1 UTSW 15 85867577 missense probably benign
R5996:Gtse1 UTSW 15 85864180 missense probably benign 0.00
R6179:Gtse1 UTSW 15 85868957 missense possibly damaging 0.95
R6379:Gtse1 UTSW 15 85864224 missense probably benign 0.01
R6434:Gtse1 UTSW 15 85875169 missense probably benign 0.21
R7086:Gtse1 UTSW 15 85875549 missense probably damaging 1.00
R7304:Gtse1 UTSW 15 85871547 missense probably benign 0.00
R7485:Gtse1 UTSW 15 85868700 missense probably benign 0.04
R7580:Gtse1 UTSW 15 85862231 missense probably damaging 1.00
R7856:Gtse1 UTSW 15 85864141 missense probably benign 0.09
R8496:Gtse1 UTSW 15 85862082 missense probably damaging 1.00
R8674:Gtse1 UTSW 15 85862175 missense probably damaging 1.00
R8987:Gtse1 UTSW 15 85868908 missense probably benign 0.00
R9491:Gtse1 UTSW 15 85871533 missense probably damaging 1.00
Z1176:Gtse1 UTSW 15 85868746 missense possibly damaging 0.85
Z1177:Gtse1 UTSW 15 85875737 missense probably damaging 0.96
Predicted Primers PCR Primer
(F):5'- AGGTAAACATGCGTTTTCTTCC -3'
(R):5'- CTGTGAGTCCTGCACAAACG -3'

Sequencing Primer
(F):5'- CCTAACCCCTGGTATAGACAGGTTC -3'
(R):5'- GTGAGTCCTGCACAAACGTTTCC -3'
Posted On 2018-05-04