Incidental Mutation 'R6381:Olfr90'
ID 515343
Institutional Source Beutler Lab
Gene Symbol Olfr90
Ensembl Gene ENSMUSG00000056600
Gene Name olfactory receptor 90
Synonyms MOR256-21, GA_x6K02T2PSCP-1526227-1525295
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.066) question?
Stock # R6381 (G1)
Quality Score 225.009
Status Validated
Chromosome 17
Chromosomal Location 37083871-37088499 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) C to T at 37086085 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Valine to Isoleucine at position 27 (V27I)
Ref Sequence ENSEMBL: ENSMUSP00000150119 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000070808] [ENSMUST00000207101] [ENSMUST00000215195] [ENSMUST00000216376] [ENSMUST00000216488] [ENSMUST00000217372] [ENSMUST00000217397]
AlphaFold Q0VEL5
Predicted Effect probably benign
Transcript: ENSMUST00000070808
AA Change: V27I

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
SMART Domains Protein: ENSMUSP00000065322
Gene: ENSMUSG00000056600
AA Change: V27I

DomainStartEndE-ValueType
Pfam:7TM_GPCR_Srbc 21 157 9e-8 PFAM
Pfam:7tm_4 29 306 5.3e-52 PFAM
Pfam:7tm_1 39 288 6.1e-27 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000207101
AA Change: V27I

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
Predicted Effect probably benign
Transcript: ENSMUST00000215195
AA Change: V27I

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000215502
Predicted Effect probably benign
Transcript: ENSMUST00000216376
Predicted Effect probably benign
Transcript: ENSMUST00000216488
AA Change: V27I

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
Predicted Effect probably benign
Transcript: ENSMUST00000217372
Predicted Effect probably benign
Transcript: ENSMUST00000217397
AA Change: V27I

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.2%
  • 20x: 97.2%
Validation Efficiency 97% (56/58)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930503L19Rik T A 18: 70,467,717 M365L probably damaging Het
5330417C22Rik T C 3: 108,481,814 K222E possibly damaging Het
Aars2 A G 17: 45,518,545 E786G probably benign Het
Adamts12 G T 15: 11,256,994 V478F possibly damaging Het
Akr1c21 T A 13: 4,574,184 D12E probably damaging Het
Aplf A T 6: 87,658,977 M118K probably damaging Het
Apobec1 A G 6: 122,578,931 L189P probably damaging Het
BC061237 A G 14: 44,504,256 Q152R possibly damaging Het
Bche A G 3: 73,701,799 I98T probably benign Het
Cc2d2a G T 5: 43,715,776 R983L possibly damaging Het
Ccnd3 T C 17: 47,505,224 probably benign Het
Cd74 G T 18: 60,811,363 C215F probably damaging Het
Cep97 C T 16: 55,922,171 A138T probably damaging Het
Ces1e T A 8: 93,217,578 N204I probably damaging Het
Dicer1 T C 12: 104,696,462 D1620G probably benign Het
Dnah17 A G 11: 118,129,185 V12A probably benign Het
Dstyk T A 1: 132,456,765 probably null Het
Eml2 G A 7: 19,201,163 V432I probably damaging Het
Gm10570 G T 4: 130,308,228 probably benign Het
Gm7145 C T 1: 117,985,939 Q184* probably null Het
Gpat2 G C 2: 127,431,918 G294R possibly damaging Het
Gtse1 G A 15: 85,862,148 R55H probably benign Het
Hdac4 G T 1: 91,984,525 Q381K possibly damaging Het
Ifit3b T C 19: 34,612,471 I349T probably benign Het
Inpp5a A T 7: 139,400,673 D9V probably benign Het
Irs1 T C 1: 82,287,684 N937S possibly damaging Het
Kcna4 T C 2: 107,294,972 M17T probably benign Het
Lipa T A 19: 34,524,746 M33L probably benign Het
March6 G T 15: 31,467,692 Q790K probably benign Het
Mccc1 G A 3: 35,976,727 P397S probably benign Het
Mrgprb2 T C 7: 48,552,390 I196V probably benign Het
Myh15 T A 16: 49,101,481 S463R probably damaging Het
Nab2 T C 10: 127,664,351 K291E probably damaging Het
Neto2 T C 8: 85,642,509 T294A probably damaging Het
Nkx1-1 T C 5: 33,433,976 M1V probably null Het
Pla2g4c C T 7: 13,344,008 T357I probably benign Het
Psmd2 A G 16: 20,655,273 E242G probably benign Het
Rnase12 A C 14: 51,057,094 Y43D probably damaging Het
Rpl18 T A 7: 45,719,592 F58I probably damaging Het
Ryr1 T G 7: 29,075,257 M2313L possibly damaging Het
Scn4a G T 11: 106,320,311 Q1627K probably damaging Het
Scnn1g A G 7: 121,767,499 S640G probably benign Het
Sdccag3 A G 2: 26,385,081 probably null Het
Sdr9c7 T A 10: 127,903,673 M219K probably benign Het
Soat1 A T 1: 156,435,803 M392K probably damaging Het
Spata18 G T 5: 73,675,216 K337N probably damaging Het
Supt16 A G 14: 52,179,546 V325A probably benign Het
Syt2 A G 1: 134,746,850 E342G probably damaging Het
Tars2 A T 3: 95,754,487 L37* probably null Het
Tep1 T C 14: 50,845,431 D1040G probably damaging Het
Tmc8 A T 11: 117,791,600 S613C probably null Het
Top3a C T 11: 60,744,023 C660Y probably damaging Het
Tpsg1 C T 17: 25,372,569 R48C probably damaging Het
Vmn2r57 T C 7: 41,428,818 N72S probably benign Het
Whrn G A 4: 63,472,684 T269I probably benign Het
Zfp759 T A 13: 67,138,905 Y173* probably null Het
Other mutations in Olfr90
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01628:Olfr90 APN 17 37085300 nonsense probably null
IGL01893:Olfr90 APN 17 37085868 missense probably damaging 0.99
IGL02036:Olfr90 APN 17 37085667 missense probably damaging 1.00
IGL02851:Olfr90 APN 17 37086156 splice site probably null
R1701:Olfr90 UTSW 17 37085731 missense probably benign 0.17
R1934:Olfr90 UTSW 17 37086014 missense possibly damaging 0.69
R3773:Olfr90 UTSW 17 37086065 nonsense probably null
R4570:Olfr90 UTSW 17 37085579 missense probably damaging 1.00
R4571:Olfr90 UTSW 17 37085579 missense probably damaging 1.00
R4888:Olfr90 UTSW 17 37085451 missense probably damaging 1.00
R4914:Olfr90 UTSW 17 37085991 missense probably damaging 1.00
R5014:Olfr90 UTSW 17 37085554 missense probably benign 0.01
R7163:Olfr90 UTSW 17 37086045 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGGTTGAACAGCATCTGGGG -3'
(R):5'- GAAAAGTCCTTAGGTGACGGGC -3'

Sequencing Primer
(F):5'- TTGAACAGCATCTGGGGGACAC -3'
(R):5'- CCTGAGAAACATCAGTCTACCTTGTG -3'
Posted On 2018-05-04