Mutagenetix > Incidental Mutation

Incidental Mutation 'R6381:Aars2'

515344

Institutional Source

Beutler Lab

Gene Symbol

Aars2

Ensembl Gene

ENSMUSG00000023938

Gene Name

alanyl-tRNA synthetase 2, mitochondrial

Synonyms

Aarsl

MMRRC Submission

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R6381 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

45506841-45520842 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 45518545 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Glutamic Acid to Glycine at position 786 (E786G)

Ref Sequence

ENSEMBL: ENSMUSP00000024733 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000024733] [ENSMUST00000113547]

AlphaFold

Q14CH7

Predicted Effect

probably benign
Transcript: ENSMUST00000024733
AA Change: E786G

PolyPhen 2 Score 0.044 (Sensitivity: 0.94; Specificity: 0.83)

SMART Domains

Protein: ENSMUSP00000024733
Gene: ENSMUSG00000023938
AA Change: E786G

Domain	Start	End	E-Value	Type
low complexity region	2	15	N/A	INTRINSIC
Pfam:tRNA-synt_2c	36	619	4e-175	PFAM
low complexity region	663	674	N/A	INTRINSIC
tRNA_SAD	716	774	2.65e-10	SMART
coiled coil region	833	863	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000113547

SMART Domains

Protein: ENSMUSP00000109175
Gene: ENSMUSG00000023949

Domain	Start	End	E-Value	Type
low complexity region	6	17	N/A	INTRINSIC
low complexity region	28	47	N/A	INTRINSIC
low complexity region	206	222	N/A	INTRINSIC
Blast:LRR	235	274	7e-14	BLAST
LRR	304	331	5.02e-6	SMART
LRR	332	358	1.28e-3	SMART
LRR	359	386	5.81e-2	SMART
LRR	387	414	2.05e-2	SMART
LRR	415	442	1.13e-4	SMART
Blast:LRR	443	470	3e-8	BLAST

Meta Mutation Damage Score

0.1010

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.2%
20x: 97.2%

Validation Efficiency

97% (56/58)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the class-II aminoacyl-tRNA synthetase family. Aminoacyl-tRNA synthetases play critical roles in mRNA translation by charging tRNAs with their cognate amino acids. The encoded protein is a mitochondrial enzyme that specifically aminoacylates alanyl-tRNA. Mutations in this gene are a cause of combined oxidative phosphorylation deficiency 8. [provided by RefSeq, Dec 2011]

Allele List at MGI

Other mutations in this stock

Total: 56 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4930503L19Rik	T	A	18: 70,467,717	M365L	probably damaging	Het
5330417C22Rik	T	C	3: 108,481,814	K222E	possibly damaging	Het
Adamts12	G	T	15: 11,256,994	V478F	possibly damaging	Het
Akr1c21	T	A	13: 4,574,184	D12E	probably damaging	Het
Aplf	A	T	6: 87,658,977	M118K	probably damaging	Het
Apobec1	A	G	6: 122,578,931	L189P	probably damaging	Het
BC061237	A	G	14: 44,504,256	Q152R	possibly damaging	Het
Bche	A	G	3: 73,701,799	I98T	probably benign	Het
Cc2d2a	G	T	5: 43,715,776	R983L	possibly damaging	Het
Ccnd3	T	C	17: 47,505,224		probably benign	Het
Cd74	G	T	18: 60,811,363	C215F	probably damaging	Het
Cep97	C	T	16: 55,922,171	A138T	probably damaging	Het
Ces1e	T	A	8: 93,217,578	N204I	probably damaging	Het
Dicer1	T	C	12: 104,696,462	D1620G	probably benign	Het
Dnah17	A	G	11: 118,129,185	V12A	probably benign	Het
Dstyk	T	A	1: 132,456,765		probably null	Het
Eml2	G	A	7: 19,201,163	V432I	probably damaging	Het
Gm10570	G	T	4: 130,308,228		probably benign	Het
Gm7145	C	T	1: 117,985,939	Q184*	probably null	Het
Gpat2	G	C	2: 127,431,918	G294R	possibly damaging	Het
Gtse1	G	A	15: 85,862,148	R55H	probably benign	Het
Hdac4	G	T	1: 91,984,525	Q381K	possibly damaging	Het
Ifit3b	T	C	19: 34,612,471	I349T	probably benign	Het
Inpp5a	A	T	7: 139,400,673	D9V	probably benign	Het
Irs1	T	C	1: 82,287,684	N937S	possibly damaging	Het
Kcna4	T	C	2: 107,294,972	M17T	probably benign	Het
Lipa	T	A	19: 34,524,746	M33L	probably benign	Het
March6	G	T	15: 31,467,692	Q790K	probably benign	Het
Mccc1	G	A	3: 35,976,727	P397S	probably benign	Het
Mrgprb2	T	C	7: 48,552,390	I196V	probably benign	Het
Myh15	T	A	16: 49,101,481	S463R	probably damaging	Het
Nab2	T	C	10: 127,664,351	K291E	probably damaging	Het
Neto2	T	C	8: 85,642,509	T294A	probably damaging	Het
Nkx1-1	T	C	5: 33,433,976	M1V	probably null	Het
Olfr90	C	T	17: 37,086,085	V27I	probably benign	Het
Pla2g4c	C	T	7: 13,344,008	T357I	probably benign	Het
Psmd2	A	G	16: 20,655,273	E242G	probably benign	Het
Rnase12	A	C	14: 51,057,094	Y43D	probably damaging	Het
Rpl18	T	A	7: 45,719,592	F58I	probably damaging	Het
Ryr1	T	G	7: 29,075,257	M2313L	possibly damaging	Het
Scn4a	G	T	11: 106,320,311	Q1627K	probably damaging	Het
Scnn1g	A	G	7: 121,767,499	S640G	probably benign	Het
Sdccag3	A	G	2: 26,385,081		probably null	Het
Sdr9c7	T	A	10: 127,903,673	M219K	probably benign	Het
Soat1	A	T	1: 156,435,803	M392K	probably damaging	Het
Spata18	G	T	5: 73,675,216	K337N	probably damaging	Het
Supt16	A	G	14: 52,179,546	V325A	probably benign	Het
Syt2	A	G	1: 134,746,850	E342G	probably damaging	Het
Tars2	A	T	3: 95,754,487	L37*	probably null	Het
Tep1	T	C	14: 50,845,431	D1040G	probably damaging	Het
Tmc8	A	T	11: 117,791,600	S613C	probably null	Het
Top3a	C	T	11: 60,744,023	C660Y	probably damaging	Het
Tpsg1	C	T	17: 25,372,569	R48C	probably damaging	Het
Vmn2r57	T	C	7: 41,428,818	N72S	probably benign	Het
Whrn	G	A	4: 63,472,684	T269I	probably benign	Het
Zfp759	T	A	13: 67,138,905	Y173*	probably null	Het

Other mutations in Aars2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL02958:Aars2	APN	17	45518172	missense	probably benign	0.00
dread_pirate	UTSW	17	45516564	missense	probably damaging	1.00
R0266:Aars2	UTSW	17	45507510	splice site	probably benign
R0315:Aars2	UTSW	17	45515452	missense	possibly damaging	0.67
R0375:Aars2	UTSW	17	45514550	missense	probably damaging	0.99
R0629:Aars2	UTSW	17	45507547	missense	probably damaging	0.99
R0981:Aars2	UTSW	17	45520331	missense	probably damaging	1.00
R1878:Aars2	UTSW	17	45514638	critical splice donor site	probably null
R1893:Aars2	UTSW	17	45514799	missense	probably benign	0.14
R2035:Aars2	UTSW	17	45514801	missense	possibly damaging	0.87
R2099:Aars2	UTSW	17	45506894	missense	unknown
R4342:Aars2	UTSW	17	45516495	missense	probably benign
R4600:Aars2	UTSW	17	45516921	missense	probably damaging	1.00
R4601:Aars2	UTSW	17	45516921	missense	probably damaging	1.00
R4610:Aars2	UTSW	17	45516921	missense	probably damaging	1.00
R5158:Aars2	UTSW	17	45514829	missense	probably benign	0.07
R5943:Aars2	UTSW	17	45517711	missense	probably benign	0.30
R5992:Aars2	UTSW	17	45508623	nonsense	probably null
R6255:Aars2	UTSW	17	45514609	missense	probably damaging	1.00
R6392:Aars2	UTSW	17	45514600	missense	probably damaging	0.98
R6406:Aars2	UTSW	17	45506939	missense	probably benign	0.16
R6648:Aars2	UTSW	17	45516564	missense	probably damaging	1.00
R7135:Aars2	UTSW	17	45508961	nonsense	probably null
R7197:Aars2	UTSW	17	45508959	missense	probably damaging	1.00
R7203:Aars2	UTSW	17	45516571	missense	probably damaging	1.00
R7289:Aars2	UTSW	17	45507624	missense	probably damaging	0.99
R7669:Aars2	UTSW	17	45520295	missense	probably benign	0.06
R8303:Aars2	UTSW	17	45507597	missense	probably damaging	1.00
R8772:Aars2	UTSW	17	45516977	missense	probably benign	0.19
R8795:Aars2	UTSW	17	45507672	missense	probably damaging	0.99
R9069:Aars2	UTSW	17	45507597	missense	probably damaging	1.00
R9206:Aars2	UTSW	17	45509404	missense	probably benign	0.03
R9342:Aars2	UTSW	17	45507076	missense	possibly damaging	0.94
R9467:Aars2	UTSW	17	45516484	missense	probably benign	0.01

Predicted Primers

PCR Primer
(F):5'- CTGGAGACTTCTGAATGGGG -3'
(R):5'- AAGACAAACATCTAGGCCGG -3'

Sequencing Primer
(F):5'- TGGTAACACACACTGCTGG -3'
(R):5'- ACATCTAGGCCGGCTGGAAG -3'

Posted On

2018-05-04