Incidental Mutation 'R6381:Lipa'
ID515347
Institutional Source Beutler Lab
Gene Symbol Lipa
Ensembl Gene ENSMUSG00000024781
Gene Namelysosomal acid lipase A
SynonymsLal, Lip1, Lip-1
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6381 (G1)
Quality Score225.009
Status Validated
Chromosome19
Chromosomal Location34492318-34527474 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 34524746 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Leucine at position 33 (M33L)
Ref Sequence ENSEMBL: ENSMUSP00000136967 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000049572] [ENSMUST00000178114]
Predicted Effect probably benign
Transcript: ENSMUST00000049572
AA Change: M33L

PolyPhen 2 Score 0.037 (Sensitivity: 0.94; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000053270
Gene: ENSMUSG00000024781
AA Change: M33L

DomainStartEndE-ValueType
Pfam:Abhydro_lipase 35 97 1.4e-27 PFAM
Pfam:Abhydrolase_5 78 373 2.6e-11 PFAM
Pfam:Abhydrolase_6 80 382 2.2e-10 PFAM
Pfam:Abhydrolase_1 111 388 1e-27 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000178114
AA Change: M33L

PolyPhen 2 Score 0.037 (Sensitivity: 0.94; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000136967
Gene: ENSMUSG00000024781
AA Change: M33L

DomainStartEndE-ValueType
Pfam:Abhydro_lipase 35 97 1.3e-27 PFAM
Pfam:Abhydrolase_5 78 373 2.5e-11 PFAM
Pfam:Abhydrolase_1 78 379 3.9e-31 PFAM
Meta Mutation Damage Score 0.6366 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.2%
  • 20x: 97.2%
Validation Efficiency 97% (56/58)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes lipase A, the lysosomal acid lipase (also known as cholesterol ester hydrolase). This enzyme functions in the lysosome to catalyze the hydrolysis of cholesteryl esters and triglycerides. Mutations in this gene can result in Wolman disease and cholesteryl ester storage disease. Alternatively spliced transcript variants have been found for this gene. [provided by RefSeq, Jan 2014]
PHENOTYPE: Homozygous null mice show massive accumulation of triglycerides and cholesteryl esters in several organs, depletion of white and brown fat, hepatosplenomegaly, increased energy intake and plasma free fatty acid levels, insulin resistance, lung inflammation, alveolar destruction and premature death. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930503L19Rik T A 18: 70,467,717 M365L probably damaging Het
5330417C22Rik T C 3: 108,481,814 K222E possibly damaging Het
Aars2 A G 17: 45,518,545 E786G probably benign Het
Adamts12 G T 15: 11,256,994 V478F possibly damaging Het
Akr1c21 T A 13: 4,574,184 D12E probably damaging Het
Aplf A T 6: 87,658,977 M118K probably damaging Het
Apobec1 A G 6: 122,578,931 L189P probably damaging Het
BC061237 A G 14: 44,504,256 Q152R possibly damaging Het
Bche A G 3: 73,701,799 I98T probably benign Het
Cc2d2a G T 5: 43,715,776 R983L possibly damaging Het
Ccnd3 T C 17: 47,505,224 probably benign Het
Cd74 G T 18: 60,811,363 C215F probably damaging Het
Cep97 C T 16: 55,922,171 A138T probably damaging Het
Ces1e T A 8: 93,217,578 N204I probably damaging Het
Dicer1 T C 12: 104,696,462 D1620G probably benign Het
Dnah17 A G 11: 118,129,185 V12A probably benign Het
Dstyk T A 1: 132,456,765 probably null Het
Eml2 G A 7: 19,201,163 V432I probably damaging Het
Gm10570 G T 4: 130,308,228 probably benign Het
Gm7145 C T 1: 117,985,939 Q184* probably null Het
Gpat2 G C 2: 127,431,918 G294R possibly damaging Het
Gtse1 G A 15: 85,862,148 R55H probably benign Het
Hdac4 G T 1: 91,984,525 Q381K possibly damaging Het
Ifit3b T C 19: 34,612,471 I349T probably benign Het
Inpp5a A T 7: 139,400,673 D9V probably benign Het
Irs1 T C 1: 82,287,684 N937S possibly damaging Het
Kcna4 T C 2: 107,294,972 M17T probably benign Het
March6 G T 15: 31,467,692 Q790K probably benign Het
Mccc1 G A 3: 35,976,727 P397S probably benign Het
Mrgprb2 T C 7: 48,552,390 I196V probably benign Het
Myh15 T A 16: 49,101,481 S463R probably damaging Het
Nab2 T C 10: 127,664,351 K291E probably damaging Het
Neto2 T C 8: 85,642,509 T294A probably damaging Het
Nkx1-1 T C 5: 33,433,976 M1V probably null Het
Olfr90 C T 17: 37,086,085 V27I probably benign Het
Pla2g4c C T 7: 13,344,008 T357I probably benign Het
Psmd2 A G 16: 20,655,273 E242G probably benign Het
Rnase12 A C 14: 51,057,094 Y43D probably damaging Het
Rpl18 T A 7: 45,719,592 F58I probably damaging Het
Ryr1 T G 7: 29,075,257 M2313L possibly damaging Het
Scn4a G T 11: 106,320,311 Q1627K probably damaging Het
Scnn1g A G 7: 121,767,499 S640G probably benign Het
Sdccag3 A G 2: 26,385,081 probably null Het
Sdr9c7 T A 10: 127,903,673 M219K probably benign Het
Soat1 A T 1: 156,435,803 M392K probably damaging Het
Spata18 G T 5: 73,675,216 K337N probably damaging Het
Supt16 A G 14: 52,179,546 V325A probably benign Het
Syt2 A G 1: 134,746,850 E342G probably damaging Het
Tars2 A T 3: 95,754,487 L37* probably null Het
Tep1 T C 14: 50,845,431 D1040G probably damaging Het
Tmc8 A T 11: 117,791,600 S613C probably null Het
Top3a C T 11: 60,744,023 C660Y probably damaging Het
Tpsg1 C T 17: 25,372,569 R48C probably damaging Het
Vmn2r57 T C 7: 41,428,818 N72S probably benign Het
Whrn G A 4: 63,472,684 T269I probably benign Het
Zfp759 T A 13: 67,138,905 Y173* probably null Het
Other mutations in Lipa
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02469:Lipa APN 19 34494035 missense probably damaging 1.00
IGL02517:Lipa APN 19 34494122 missense possibly damaging 0.47
IGL02869:Lipa APN 19 34493997 missense probably benign 0.01
IGL02869:Lipa APN 19 34493971 utr 3 prime probably benign
buckboard UTSW 19 34524746 missense probably benign 0.04
Pashtun UTSW 19 34510928 missense probably damaging 1.00
suri UTSW 19 34501634 nonsense probably null
R0071:Lipa UTSW 19 34495082 missense probably damaging 1.00
R0244:Lipa UTSW 19 34501541 missense probably damaging 1.00
R1871:Lipa UTSW 19 34510928 missense probably damaging 1.00
R1929:Lipa UTSW 19 34510890 nonsense probably null
R2189:Lipa UTSW 19 34524799 missense probably benign 0.13
R2270:Lipa UTSW 19 34510890 nonsense probably null
R2271:Lipa UTSW 19 34510890 nonsense probably null
R2272:Lipa UTSW 19 34510890 nonsense probably null
R4737:Lipa UTSW 19 34501634 nonsense probably null
R5713:Lipa UTSW 19 34523432 missense probably benign 0.00
RF012:Lipa UTSW 19 34509098 missense probably damaging 1.00
X0067:Lipa UTSW 19 34509020 nonsense probably null
Predicted Primers PCR Primer
(F):5'- GCAGTATCTAGTGGGGAAACTG -3'
(R):5'- AACAGATTGATGTCCCCGCC -3'

Sequencing Primer
(F):5'- AAACTGTAGCTTGGCATCTGC -3'
(R):5'- GGTTCAAGACTTTTAAAGAAGGCTC -3'
Posted On2018-05-04