Incidental Mutation 'R6382:Shkbp1'
ID515370
Institutional Source Beutler Lab
Gene Symbol Shkbp1
Ensembl Gene ENSMUSG00000089832
Gene NameSh3kbp1 binding protein 1
SynonymsB930062H15Rik, SB1
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6382 (G1)
Quality Score198.009
Status Validated
Chromosome7
Chromosomal Location27342133-27356019 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) C to A at 27352059 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Stop codon at position 192 (E192*)
Ref Sequence ENSEMBL: ENSMUSP00000003857 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000003857] [ENSMUST00000011895] [ENSMUST00000108362] [ENSMUST00000108363] [ENSMUST00000108364] [ENSMUST00000172269]
Predicted Effect probably null
Transcript: ENSMUST00000003857
AA Change: E192*
SMART Domains Protein: ENSMUSP00000003857
Gene: ENSMUSG00000089832
AA Change: E192*

DomainStartEndE-ValueType
BTB 19 119 1.65e-16 SMART
low complexity region 183 194 N/A INTRINSIC
Blast:WD40 196 271 1e-21 BLAST
WD40 277 313 1.9e2 SMART
WD40 419 457 3.45e-1 SMART
WD40 527 577 3.68e1 SMART
low complexity region 612 631 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000011895
SMART Domains Protein: ENSMUSP00000011895
Gene: ENSMUSG00000011751

DomainStartEndE-ValueType
low complexity region 39 45 N/A INTRINSIC
CH 64 164 8.03e-24 SMART
CH 183 281 7.38e-23 SMART
Pfam:Spectrin 310 420 1.4e-10 PFAM
SPEC 433 533 5.22e-26 SMART
SPEC 539 642 7.62e-19 SMART
SPEC 648 766 1.31e-8 SMART
SPEC 772 874 2.94e-11 SMART
SPEC 880 980 1.49e-21 SMART
SPEC 986 1081 1.65e0 SMART
SPEC 1087 1192 2.82e-13 SMART
SPEC 1198 1298 6.59e-14 SMART
SPEC 1304 1403 4.08e-19 SMART
SPEC 1409 1508 5.92e-7 SMART
SPEC 1514 1614 2.45e-22 SMART
SPEC 1620 1720 1.45e-24 SMART
SPEC 1726 1827 1.86e-22 SMART
SPEC 1833 1935 9.54e-11 SMART
SPEC 1941 2041 1.35e-19 SMART
SPEC 2047 2297 1.06e-8 SMART
low complexity region 2358 2412 N/A INTRINSIC
PH 2416 2526 1.54e-14 SMART
low complexity region 2549 2560 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000108362
SMART Domains Protein: ENSMUSP00000103999
Gene: ENSMUSG00000011751

DomainStartEndE-ValueType
SPEC 1 83 9.7e-3 SMART
SPEC 89 188 5.92e-7 SMART
SPEC 194 294 2.45e-22 SMART
SPEC 300 400 1.45e-24 SMART
SPEC 406 507 1.86e-22 SMART
SPEC 513 615 9.54e-11 SMART
SPEC 621 721 1.35e-19 SMART
SPEC 727 977 1.06e-8 SMART
low complexity region 1038 1092 N/A INTRINSIC
PH 1096 1206 1.54e-14 SMART
low complexity region 1229 1240 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000108363
SMART Domains Protein: ENSMUSP00000104000
Gene: ENSMUSG00000011751

DomainStartEndE-ValueType
SPEC 1 83 9.7e-3 SMART
SPEC 89 188 5.92e-7 SMART
SPEC 194 294 2.45e-22 SMART
SPEC 300 400 1.45e-24 SMART
SPEC 406 507 1.86e-22 SMART
SPEC 513 615 9.54e-11 SMART
SPEC 621 721 1.35e-19 SMART
SPEC 727 977 1.06e-8 SMART
low complexity region 1038 1092 N/A INTRINSIC
PH 1096 1206 1.54e-14 SMART
low complexity region 1229 1240 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000108364
SMART Domains Protein: ENSMUSP00000104001
Gene: ENSMUSG00000011751

DomainStartEndE-ValueType
SPEC 1 83 9.7e-3 SMART
SPEC 89 188 5.92e-7 SMART
SPEC 194 294 2.45e-22 SMART
SPEC 300 400 1.45e-24 SMART
SPEC 406 507 1.86e-22 SMART
SPEC 513 615 9.54e-11 SMART
SPEC 621 721 1.35e-19 SMART
SPEC 727 977 1.06e-8 SMART
low complexity region 1038 1092 N/A INTRINSIC
PH 1096 1206 1.54e-14 SMART
low complexity region 1229 1240 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000123190
Predicted Effect probably benign
Transcript: ENSMUST00000126587
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132046
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132684
Predicted Effect noncoding transcript
Transcript: ENSMUST00000136589
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138449
Predicted Effect noncoding transcript
Transcript: ENSMUST00000143239
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152053
Predicted Effect noncoding transcript
Transcript: ENSMUST00000157078
Predicted Effect probably benign
Transcript: ENSMUST00000172269
SMART Domains Protein: ENSMUSP00000132807
Gene: ENSMUSG00000011751

DomainStartEndE-ValueType
low complexity region 39 45 N/A INTRINSIC
CH 64 164 8.03e-24 SMART
CH 183 281 7.38e-23 SMART
Pfam:Spectrin 310 420 1.9e-10 PFAM
SPEC 433 533 5.22e-26 SMART
SPEC 539 637 3.45e-17 SMART
SPEC 643 761 1.31e-8 SMART
SPEC 767 869 2.94e-11 SMART
SPEC 875 975 1.49e-21 SMART
SPEC 981 1076 1.65e0 SMART
SPEC 1082 1187 2.82e-13 SMART
SPEC 1193 1293 6.59e-14 SMART
SPEC 1299 1398 4.08e-19 SMART
SPEC 1404 1503 5.92e-7 SMART
SPEC 1509 1609 2.45e-22 SMART
SPEC 1615 1715 1.45e-24 SMART
SPEC 1721 1822 1.86e-22 SMART
SPEC 1828 1930 9.54e-11 SMART
SPEC 1936 2036 1.35e-19 SMART
SPEC 2042 2292 1.06e-8 SMART
low complexity region 2352 2406 N/A INTRINSIC
PH 2410 2520 1.54e-14 SMART
low complexity region 2543 2554 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 97.5%
Validation Efficiency 100% (55/55)
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abat T A 16: 8,600,986 M148K probably benign Het
Aldoc T C 11: 78,325,742 I242T probably benign Het
Camta2 T C 11: 70,672,041 T927A probably damaging Het
Ccdc105 G A 10: 78,752,841 T45I possibly damaging Het
Ccdc30 T C 4: 119,404,166 R25G possibly damaging Het
Cdh16 T A 8: 104,621,543 M181L possibly damaging Het
Clstn1 A T 4: 149,626,120 probably null Het
Cnot6l C A 5: 96,128,999 R110L probably damaging Het
Col7a1 G A 9: 108,975,393 S2264N unknown Het
Cspp1 A G 1: 10,083,475 probably null Het
Cul1 T A 6: 47,502,439 L213Q probably damaging Het
Cuta T C 17: 26,938,454 Q124R probably benign Het
Cyp1a1 T A 9: 57,700,690 N200K probably damaging Het
Dag1 C A 9: 108,208,137 A602S possibly damaging Het
Gm4707 G A 17: 71,459,243 probably benign Het
Gm813 T C 16: 58,613,910 E148G possibly damaging Het
Gpat2 G C 2: 127,431,918 G294R possibly damaging Het
H2-T23 T C 17: 36,031,832 Y138C probably damaging Het
Hnf4a A T 2: 163,569,006 M408L probably benign Het
Hpse2 A G 19: 43,388,202 L37P possibly damaging Het
Hsd17b6 A T 10: 127,991,327 I292N probably damaging Het
Hsp90aa1 A T 12: 110,695,517 probably null Het
Ifit1bl1 T A 19: 34,594,883 Y58F probably benign Het
Igkv10-95 A G 6: 68,680,688 T43A probably benign Het
Igkv6-17 C T 6: 70,371,830 Q62* probably null Het
Jakmip2 A G 18: 43,571,179 S367P possibly damaging Het
Lrrc40 A G 3: 158,058,696 D416G probably damaging Het
Mdm2 A G 10: 117,692,721 V177A probably benign Het
Mpp1 TGAGACGAACTCTCCGAG TGAG X: 75,125,769 probably null Het
Myo1b C T 1: 51,774,307 probably null Het
Notch2 A G 3: 98,141,543 D1799G probably damaging Het
Obscn C T 11: 58,999,413 G7431D unknown Het
Obscn A T 11: 59,042,208 C4781S probably damaging Het
Olfr1351 C A 10: 79,017,517 S65Y probably damaging Het
Olfr237-ps1 T A 6: 43,153,965 I220N probably damaging Het
Pard3 T A 8: 127,376,783 V411D probably damaging Het
Pfkl T C 10: 77,999,837 R246G probably damaging Het
Pgs1 T C 11: 118,003,360 Y238H probably damaging Het
Pik3c2g A G 6: 139,719,998 E15G possibly damaging Het
Pja2 A G 17: 64,309,615 V95A probably benign Het
Ripor2 T C 13: 24,677,845 I207T possibly damaging Het
Rps15 A G 10: 80,293,986 Y115C probably damaging Het
Slc23a4 T A 6: 34,957,043 M42L probably benign Het
Snx25 T A 8: 46,055,991 S373C probably benign Het
Sppl2a A T 2: 126,917,029 probably null Het
Tpcn2 A G 7: 145,269,749 S256P possibly damaging Het
Txk C T 5: 72,736,480 probably benign Het
Ubr2 C G 17: 46,957,315 W991S possibly damaging Het
Ufc1 A G 1: 171,294,675 W28R probably damaging Het
Unc93b1 C A 19: 3,935,297 A35E probably benign Het
Ush2a A G 1: 188,814,302 N3425S probably benign Het
Vmn1r32 A G 6: 66,553,361 Y144H probably benign Het
Vmn1r76 A G 7: 11,930,499 F228L probably damaging Het
Zfc3h1 A G 10: 115,407,908 N715D probably benign Het
Zfp933 T C 4: 147,825,868 S424G probably benign Het
Other mutations in Shkbp1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01327:Shkbp1 APN 7 27355251 missense probably benign 0.28
IGL01469:Shkbp1 APN 7 27355941 missense probably benign
IGL01787:Shkbp1 APN 7 27342450 missense possibly damaging 0.93
IGL02149:Shkbp1 APN 7 27342639 unclassified probably benign
IGL02902:Shkbp1 APN 7 27342716 missense probably damaging 0.97
R0086:Shkbp1 UTSW 7 27352026 missense probably benign 0.00
R0219:Shkbp1 UTSW 7 27352061 missense probably benign 0.01
R0485:Shkbp1 UTSW 7 27348581 missense probably damaging 1.00
R1036:Shkbp1 UTSW 7 27345296 missense possibly damaging 0.86
R1468:Shkbp1 UTSW 7 27345326 missense probably damaging 1.00
R1468:Shkbp1 UTSW 7 27345326 missense probably damaging 1.00
R1608:Shkbp1 UTSW 7 27354779 missense probably benign 0.01
R1757:Shkbp1 UTSW 7 27342351 missense probably benign
R1968:Shkbp1 UTSW 7 27355400 critical splice donor site probably null
R2763:Shkbp1 UTSW 7 27347029 missense probably benign 0.05
R3027:Shkbp1 UTSW 7 27343393 missense probably benign 0.18
R3924:Shkbp1 UTSW 7 27342402 missense probably benign
R4425:Shkbp1 UTSW 7 27343302 missense probably benign 0.38
R5048:Shkbp1 UTSW 7 27352096 unclassified probably benign
R5862:Shkbp1 UTSW 7 27343404 nonsense probably null
R5955:Shkbp1 UTSW 7 27342524 missense probably benign
R6016:Shkbp1 UTSW 7 27354401 missense possibly damaging 0.92
R6226:Shkbp1 UTSW 7 27351980 missense probably null 1.00
R6362:Shkbp1 UTSW 7 27351695 critical splice donor site probably null
R6460:Shkbp1 UTSW 7 27350538 missense probably benign 0.01
R6647:Shkbp1 UTSW 7 27342375 missense probably benign
R7025:Shkbp1 UTSW 7 27355281 missense possibly damaging 0.47
R7255:Shkbp1 UTSW 7 27342748 missense possibly damaging 0.93
R7522:Shkbp1 UTSW 7 27347158 missense possibly damaging 0.88
R7571:Shkbp1 UTSW 7 27347131 missense possibly damaging 0.90
R8207:Shkbp1 UTSW 7 27352684 missense probably benign 0.01
Z1177:Shkbp1 UTSW 7 27347001 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- CTGTGGGATTGAGGGACATC -3'
(R):5'- AGAACAAACTTGGGTTGTCCGG -3'

Sequencing Primer
(F):5'- GATTGAGGGACATCAGTAACCCC -3'
(R):5'- CCAGGACTGCTTTTGTATGCTGAAC -3'
Posted On2018-05-04