Incidental Mutation 'R6382:Ripor2'
ID515391
Institutional Source Beutler Lab
Gene Symbol Ripor2
Ensembl Gene ENSMUSG00000036006
Gene NameRHO family interacting cell polarization regulator 2
Synonyms6330500D04Rik, E430013J17Rik, Fam65b, 1700108N18Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.176) question?
Stock #R6382 (G1)
Quality Score225.009
Status Validated
Chromosome13
Chromosomal Location24582189-24733816 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 24677845 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Threonine at position 207 (I207T)
Ref Sequence ENSEMBL: ENSMUSP00000089286 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000038477] [ENSMUST00000058009] [ENSMUST00000091694] [ENSMUST00000110383] [ENSMUST00000110384] [ENSMUST00000132689]
Predicted Effect possibly damaging
Transcript: ENSMUST00000038477
AA Change: I204T

PolyPhen 2 Score 0.840 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000043663
Gene: ENSMUSG00000036006
AA Change: I204T

DomainStartEndE-ValueType
coiled coil region 108 137 N/A INTRINSIC
low complexity region 461 476 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000058009
AA Change: I204T

PolyPhen 2 Score 0.840 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000051342
Gene: ENSMUSG00000036006
AA Change: I204T

DomainStartEndE-ValueType
coiled coil region 108 137 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000091694
AA Change: I207T

PolyPhen 2 Score 0.886 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000089286
Gene: ENSMUSG00000036006
AA Change: I207T

DomainStartEndE-ValueType
low complexity region 4 15 N/A INTRINSIC
coiled coil region 111 140 N/A INTRINSIC
low complexity region 422 437 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000110383
AA Change: I179T

PolyPhen 2 Score 0.840 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000106012
Gene: ENSMUSG00000036006
AA Change: I179T

DomainStartEndE-ValueType
coiled coil region 83 112 N/A INTRINSIC
low complexity region 436 451 N/A INTRINSIC
low complexity region 630 639 N/A INTRINSIC
low complexity region 657 672 N/A INTRINSIC
low complexity region 857 864 N/A INTRINSIC
SCOP:d1gw5a_ 901 1023 2e-9 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000110384
AA Change: I204T

PolyPhen 2 Score 0.840 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000106013
Gene: ENSMUSG00000036006
AA Change: I204T

DomainStartEndE-ValueType
Pfam:PL48 41 389 6e-174 PFAM
low complexity region 461 476 N/A INTRINSIC
low complexity region 655 664 N/A INTRINSIC
low complexity region 682 697 N/A INTRINSIC
low complexity region 882 889 N/A INTRINSIC
SCOP:d1gw5a_ 926 1048 2e-9 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000132689
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134370
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138547
Predicted Effect noncoding transcript
Transcript: ENSMUST00000176303
Predicted Effect noncoding transcript
Transcript: ENSMUST00000177174
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 97.5%
Validation Efficiency 100% (55/55)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an atypical inhibitor of the small G protein RhoA. Inhibition of RhoA activity by the encoded protein mediates myoblast fusion and polarization of T cells and neutrophils. The encoded protein is a component of hair cell stereocilia that is essential for hearing. A splice site mutation in this gene results in hearing loss in human patients. [provided by RefSeq, Sep 2016]
PHENOTYPE: Homozygous knockout mice are deaf. The gene product is expressed in the basal region of cochlear hair cell stereocillia, which are disorganized and malformed in null mice. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abat T A 16: 8,600,986 M148K probably benign Het
Aldoc T C 11: 78,325,742 I242T probably benign Het
Camta2 T C 11: 70,672,041 T927A probably damaging Het
Ccdc105 G A 10: 78,752,841 T45I possibly damaging Het
Ccdc30 T C 4: 119,404,166 R25G possibly damaging Het
Cdh16 T A 8: 104,621,543 M181L possibly damaging Het
Clstn1 A T 4: 149,626,120 probably null Het
Cnot6l C A 5: 96,128,999 R110L probably damaging Het
Col7a1 G A 9: 108,975,393 S2264N unknown Het
Cspp1 A G 1: 10,083,475 probably null Het
Cul1 T A 6: 47,502,439 L213Q probably damaging Het
Cuta T C 17: 26,938,454 Q124R probably benign Het
Cyp1a1 T A 9: 57,700,690 N200K probably damaging Het
Dag1 C A 9: 108,208,137 A602S possibly damaging Het
Gm4707 G A 17: 71,459,243 probably benign Het
Gm813 T C 16: 58,613,910 E148G possibly damaging Het
Gpat2 G C 2: 127,431,918 G294R possibly damaging Het
H2-T23 T C 17: 36,031,832 Y138C probably damaging Het
Hnf4a A T 2: 163,569,006 M408L probably benign Het
Hpse2 A G 19: 43,388,202 L37P possibly damaging Het
Hsd17b6 A T 10: 127,991,327 I292N probably damaging Het
Hsp90aa1 A T 12: 110,695,517 probably null Het
Ifit1bl1 T A 19: 34,594,883 Y58F probably benign Het
Igkv10-95 A G 6: 68,680,688 T43A probably benign Het
Igkv6-17 C T 6: 70,371,830 Q62* probably null Het
Jakmip2 A G 18: 43,571,179 S367P possibly damaging Het
Lrrc40 A G 3: 158,058,696 D416G probably damaging Het
Mdm2 A G 10: 117,692,721 V177A probably benign Het
Mpp1 TGAGACGAACTCTCCGAG TGAG X: 75,125,769 probably null Het
Myo1b C T 1: 51,774,307 probably null Het
Notch2 A G 3: 98,141,543 D1799G probably damaging Het
Obscn C T 11: 58,999,413 G7431D unknown Het
Obscn A T 11: 59,042,208 C4781S probably damaging Het
Olfr1351 C A 10: 79,017,517 S65Y probably damaging Het
Olfr237-ps1 T A 6: 43,153,965 I220N probably damaging Het
Pard3 T A 8: 127,376,783 V411D probably damaging Het
Pfkl T C 10: 77,999,837 R246G probably damaging Het
Pgs1 T C 11: 118,003,360 Y238H probably damaging Het
Pik3c2g A G 6: 139,719,998 E15G possibly damaging Het
Pja2 A G 17: 64,309,615 V95A probably benign Het
Rps15 A G 10: 80,293,986 Y115C probably damaging Het
Shkbp1 C A 7: 27,352,059 E192* probably null Het
Slc23a4 T A 6: 34,957,043 M42L probably benign Het
Snx25 T A 8: 46,055,991 S373C probably benign Het
Sppl2a A T 2: 126,917,029 probably null Het
Tpcn2 A G 7: 145,269,749 S256P possibly damaging Het
Txk C T 5: 72,736,480 probably benign Het
Ubr2 C G 17: 46,957,315 W991S possibly damaging Het
Ufc1 A G 1: 171,294,675 W28R probably damaging Het
Unc93b1 C A 19: 3,935,297 A35E probably benign Het
Ush2a A G 1: 188,814,302 N3425S probably benign Het
Vmn1r32 A G 6: 66,553,361 Y144H probably benign Het
Vmn1r76 A G 7: 11,930,499 F228L probably damaging Het
Zfc3h1 A G 10: 115,407,908 N715D probably benign Het
Zfp933 T C 4: 147,825,868 S424G probably benign Het
Other mutations in Ripor2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01099:Ripor2 APN 13 24701207 missense probably benign 0.11
IGL02145:Ripor2 APN 13 24717571 missense probably damaging 1.00
IGL02351:Ripor2 APN 13 24731589 missense probably damaging 1.00
IGL02358:Ripor2 APN 13 24731589 missense probably damaging 1.00
IGL02377:Ripor2 APN 13 24695566 splice site probably benign
IGL02533:Ripor2 APN 13 24701395 nonsense probably null
IGL02798:Ripor2 APN 13 24674666 missense probably damaging 0.99
IGL02852:Ripor2 APN 13 24695698 missense probably damaging 1.00
IGL02869:Ripor2 APN 13 24696529 missense possibly damaging 0.46
IGL03219:Ripor2 APN 13 24723719 missense probably damaging 1.00
gentleman UTSW 13 24694145 missense probably damaging 1.00
Jack UTSW 13 24677841 nonsense probably null
whitechapel UTSW 13 24673112 critical splice donor site probably null
R0045:Ripor2 UTSW 13 24694226 missense probably damaging 1.00
R0101:Ripor2 UTSW 13 24680632 missense probably damaging 1.00
R0731:Ripor2 UTSW 13 24680644 missense probably damaging 1.00
R0827:Ripor2 UTSW 13 24694186 missense probably damaging 1.00
R1331:Ripor2 UTSW 13 24677841 nonsense probably null
R1374:Ripor2 UTSW 13 24673112 critical splice donor site probably null
R1564:Ripor2 UTSW 13 24675785 missense probably damaging 1.00
R1773:Ripor2 UTSW 13 24701254 missense probably benign 0.10
R1889:Ripor2 UTSW 13 24693887 missense probably damaging 1.00
R2122:Ripor2 UTSW 13 24713718 missense probably damaging 0.98
R2137:Ripor2 UTSW 13 24721834 critical splice donor site probably null
R2209:Ripor2 UTSW 13 24701612 missense probably damaging 1.00
R2242:Ripor2 UTSW 13 24671772 missense probably benign 0.08
R2392:Ripor2 UTSW 13 24706223 missense probably benign 0.00
R2994:Ripor2 UTSW 13 24701627 missense probably damaging 0.98
R4008:Ripor2 UTSW 13 24696538 missense probably benign
R4287:Ripor2 UTSW 13 24725009 missense probably damaging 1.00
R4364:Ripor2 UTSW 13 24721711 missense probably benign 0.07
R4365:Ripor2 UTSW 13 24721711 missense probably benign 0.07
R4366:Ripor2 UTSW 13 24721711 missense probably benign 0.07
R4868:Ripor2 UTSW 13 24694141 missense possibly damaging 0.88
R5304:Ripor2 UTSW 13 24674666 missense probably damaging 0.99
R6119:Ripor2 UTSW 13 24614644 start gained probably benign
R6157:Ripor2 UTSW 13 24701069 missense probably damaging 1.00
R6178:Ripor2 UTSW 13 24710130 missense possibly damaging 0.94
R6664:Ripor2 UTSW 13 24675820 missense probably damaging 0.98
R6908:Ripor2 UTSW 13 24706232 missense probably damaging 1.00
R7023:Ripor2 UTSW 13 24671846 missense probably benign 0.00
R7041:Ripor2 UTSW 13 24693766 missense probably benign 0.18
R7196:Ripor2 UTSW 13 24704825 missense possibly damaging 0.66
R7216:Ripor2 UTSW 13 24671903 missense probably damaging 1.00
R7248:Ripor2 UTSW 13 24694145 missense probably damaging 1.00
R7299:Ripor2 UTSW 13 24725001 missense possibly damaging 0.54
R7301:Ripor2 UTSW 13 24725001 missense possibly damaging 0.54
R7343:Ripor2 UTSW 13 24701444 nonsense probably null
R7417:Ripor2 UTSW 13 24696550 missense probably damaging 1.00
R7426:Ripor2 UTSW 13 24694205 missense probably benign 0.01
R7448:Ripor2 UTSW 13 24670071 missense possibly damaging 0.71
R7462:Ripor2 UTSW 13 24696307 missense unknown
R7499:Ripor2 UTSW 13 24693772 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- ACAACAGCTTATTGGGCTTCTCTC -3'
(R):5'- CCACCATTGTCTTGCTTGGG -3'

Sequencing Primer
(F):5'- CTCAAGCAGGACGGCTATTTATCTG -3'
(R):5'- AAATGCTTGCCCACTGAC -3'
Posted On2018-05-04