Incidental Mutation 'R6383:Abca12'
ID515406
Institutional Source Beutler Lab
Gene Symbol Abca12
Ensembl Gene ENSMUSG00000050296
Gene NameATP-binding cassette, sub-family A (ABC1), member 12
Synonyms4833417A11Rik, 4832428G11Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6383 (G1)
Quality Score225.009
Status Validated
Chromosome1
Chromosomal Location71242276-71414910 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 71247184 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Lysine at position 2497 (M2497K)
Ref Sequence ENSEMBL: ENSMUSP00000084523 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000087268]
Predicted Effect probably benign
Transcript: ENSMUST00000087268
AA Change: M2497K

PolyPhen 2 Score 0.033 (Sensitivity: 0.95; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000084523
Gene: ENSMUSG00000050296
AA Change: M2497K

DomainStartEndE-ValueType
transmembrane domain 24 43 N/A INTRINSIC
low complexity region 246 259 N/A INTRINSIC
Pfam:ABC2_membrane_3 885 1267 2.9e-24 PFAM
AAA 1370 1554 4.2e-10 SMART
low complexity region 1717 1735 N/A INTRINSIC
Pfam:ABC2_membrane_3 1744 2206 9.6e-35 PFAM
AAA 2282 2467 4.61e-7 SMART
Meta Mutation Damage Score 0.0737 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 97.9%
Validation Efficiency 97% (73/75)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The membrane-associated protein encoded by this gene is a member of the superfamily of ATP-binding cassette (ABC) transporters. ABC proteins transport various molecules across extra- and intracellular membranes. ABC genes are divided into seven distinct subfamilies (ABC1, MDR/TAP, MRP, ALD, OABP, GCN20, and White). This encoded protein is a member of the ABC1 subfamily, which is the only major ABC subfamily found exclusively in multicellular eukaryotes. Alternative splicing of this gene results in multiple transcript variants. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a null allele exhibit neonatal lethality associated with defective skin development and abnormal lung morphology. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 76 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abtb2 C T 2: 103,567,376 T217I probably damaging Het
Adam29 T A 8: 55,871,508 N637I probably damaging Het
Adgb T A 10: 10,450,028 E59V probably damaging Het
Adh7 C T 3: 138,228,017 R312C probably benign Het
Adprh A G 16: 38,447,452 I157T probably damaging Het
Ap2b1 T C 11: 83,346,825 S572P probably damaging Het
Asic1 T C 15: 99,698,880 L519P probably damaging Het
Atp2a2 G C 5: 122,501,649 L13V probably benign Het
Bst2 A T 8: 71,537,288 I47N possibly damaging Het
Cacng6 G A 7: 3,424,993 probably null Het
Cenpe A G 3: 135,251,528 E1849G probably damaging Het
Cep295 T A 9: 15,332,754 T213S probably damaging Het
Chia1 A G 3: 106,131,811 T406A probably benign Het
Chmp4c G T 3: 10,367,217 K62N probably damaging Het
Cldn15 A G 5: 136,968,125 T7A probably benign Het
Cmpk2 T A 12: 26,478,020 M412K probably benign Het
Cnnm1 T C 19: 43,465,266 probably null Het
Cubn A C 2: 13,427,835 probably null Het
Dopey2 T C 16: 93,782,248 V1668A possibly damaging Het
Erg28 T A 12: 85,816,429 Y77F probably damaging Het
F830045P16Rik C T 2: 129,536,438 A9T probably benign Het
Gli3 A G 13: 15,723,555 D740G probably damaging Het
Gm13128 A T 4: 144,333,147 *476L probably null Het
Gm14085 T C 2: 122,524,807 I555T probably benign Het
Gpat2 G C 2: 127,431,918 G294R possibly damaging Het
Gpat3 A T 5: 100,893,144 M357L probably benign Het
Gpr179 A G 11: 97,337,147 V1394A possibly damaging Het
Grn T A 11: 102,436,795 probably benign Het
H2-Q6 G A 17: 35,428,383 probably null Het
Igsf3 A G 3: 101,435,648 T514A probably benign Het
Il1r1 A G 1: 40,313,335 D558G possibly damaging Het
Irx4 T C 13: 73,267,713 M207T possibly damaging Het
Kap T C 6: 133,851,957 I54V probably benign Het
Kdm2b G A 5: 122,934,778 R340C probably damaging Het
Lipo3 T A 19: 33,556,431 M334L probably benign Het
Lmbrd1 C T 1: 24,706,034 L152F probably damaging Het
Ltbp1 G A 17: 75,359,457 V1382I probably damaging Het
Map3k4 C T 17: 12,249,583 D1008N possibly damaging Het
Mcf2l T C 8: 12,879,912 probably benign Het
Mecom T G 3: 29,997,726 D180A probably damaging Het
Meis1 T C 11: 18,941,741 D269G probably benign Het
Myh7 A C 14: 54,988,894 S430A probably benign Het
Myo1h A G 5: 114,336,264 I439V probably damaging Het
Nat1 T C 8: 67,491,482 V170A possibly damaging Het
Nlrp12 A G 7: 3,234,043 L742P probably damaging Het
Nlrp4c A G 7: 6,066,053 T318A probably benign Het
Olfr1297 T A 2: 111,621,186 N296I probably benign Het
Olfr1425 T A 19: 12,074,363 I90F probably damaging Het
Olfr632 A G 7: 103,937,823 I148V probably benign Het
Olfr952 G T 9: 39,426,234 T279N probably damaging Het
Olfr955 A T 9: 39,470,630 L32Q probably damaging Het
Otop3 A G 11: 115,345,072 E529G probably damaging Het
Parp6 T C 9: 59,623,939 Y35H probably damaging Het
Pcdhb4 A C 18: 37,308,021 D128A probably damaging Het
Phldb2 C T 16: 45,748,750 D1249N probably damaging Het
Ptpn12 T A 5: 20,987,468 K765* probably null Het
Ptprb T A 10: 116,347,007 Y1529* probably null Het
Ptprc A T 1: 138,078,451 Y798N possibly damaging Het
Sdk2 G A 11: 113,832,265 T1300I probably damaging Het
Sptbn2 G A 19: 4,732,496 V487I possibly damaging Het
Sptbn5 A G 2: 120,046,269 probably benign Het
Srpk1 A G 17: 28,590,062 S648P probably damaging Het
Stard9 T C 2: 120,666,407 probably null Het
Tmem135 A T 7: 89,144,670 I388N probably damaging Het
Top3a A T 11: 60,749,459 I446N probably benign Het
Trpv1 T C 11: 73,246,036 S482P probably damaging Het
Ugt3a1 C T 15: 9,306,455 A230V probably benign Het
Vmn2r15 A C 5: 109,293,226 Y255* probably null Het
Vmn2r60 A G 7: 42,116,471 M1V probably null Het
Vmn2r87 A G 10: 130,479,000 V239A probably damaging Het
Vwce T A 19: 10,659,592 C679* probably null Het
Zfp385b C T 2: 77,415,841 A281T probably benign Het
Zfp398 T G 6: 47,866,595 L395W probably damaging Het
Zfp442 C T 2: 150,451,401 probably null Het
Zfp606 A G 7: 12,492,944 S331G probably benign Het
Zfp882 A G 8: 71,914,640 H437R probably damaging Het
Other mutations in Abca12
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00089:Abca12 APN 1 71303541 missense possibly damaging 0.64
IGL00556:Abca12 APN 1 71353757 missense probably benign 0.00
IGL00813:Abca12 APN 1 71353762 critical splice acceptor site probably null
IGL00835:Abca12 APN 1 71302733 missense probably damaging 1.00
IGL00921:Abca12 APN 1 71285729 missense probably damaging 1.00
IGL01011:Abca12 APN 1 71263632 missense probably benign 0.02
IGL01066:Abca12 APN 1 71353730 missense possibly damaging 0.95
IGL01082:Abca12 APN 1 71314114 missense probably damaging 1.00
IGL01310:Abca12 APN 1 71284156 missense probably benign 0.00
IGL01360:Abca12 APN 1 71286489 missense possibly damaging 0.95
IGL01585:Abca12 APN 1 71319886 missense probably benign 0.00
IGL01608:Abca12 APN 1 71259442 missense probably damaging 1.00
IGL01687:Abca12 APN 1 71267610 splice site probably benign
IGL01700:Abca12 APN 1 71280390 missense probably benign
IGL01723:Abca12 APN 1 71314168 missense probably benign 0.01
IGL01804:Abca12 APN 1 71276183 missense probably benign 0.01
IGL01982:Abca12 APN 1 71346698 missense probably benign 0.34
IGL02136:Abca12 APN 1 71247142 missense probably damaging 1.00
IGL02172:Abca12 APN 1 71302658 missense probably benign 0.09
IGL02222:Abca12 APN 1 71282886 missense probably benign 0.40
IGL02266:Abca12 APN 1 71268201 nonsense probably null
IGL02449:Abca12 APN 1 71401749 splice site probably null
IGL02471:Abca12 APN 1 71258198 missense probably benign 0.00
IGL02496:Abca12 APN 1 71288553 missense possibly damaging 0.55
IGL02552:Abca12 APN 1 71294747 missense probably damaging 0.96
IGL02795:Abca12 APN 1 71288748 missense probably damaging 1.00
IGL03000:Abca12 APN 1 71321800 missense probably benign 0.01
IGL03031:Abca12 APN 1 71314024 missense probably benign 0.00
IGL03131:Abca12 APN 1 71346702 missense probably benign
IGL03260:Abca12 APN 1 71284099 missense probably damaging 1.00
IGL03324:Abca12 APN 1 71314008 missense probably benign
IGL03408:Abca12 APN 1 71264795 missense probably damaging 1.00
R0016:Abca12 UTSW 1 71294800 missense probably benign 0.35
R0016:Abca12 UTSW 1 71294800 missense probably benign 0.35
R0121:Abca12 UTSW 1 71259786 splice site probably null
R0172:Abca12 UTSW 1 71279402 missense probably damaging 0.99
R0196:Abca12 UTSW 1 71259813 missense possibly damaging 0.81
R0400:Abca12 UTSW 1 71259776 splice site probably benign
R0466:Abca12 UTSW 1 71302663 missense probably damaging 1.00
R0616:Abca12 UTSW 1 71302671 missense probably damaging 1.00
R0668:Abca12 UTSW 1 71263614 missense probably damaging 1.00
R0928:Abca12 UTSW 1 71349174 missense probably benign 0.06
R1036:Abca12 UTSW 1 71263410 critical splice donor site probably null
R1086:Abca12 UTSW 1 71295061 splice site probably benign
R1300:Abca12 UTSW 1 71244808 missense probably damaging 1.00
R1337:Abca12 UTSW 1 71294819 missense probably benign 0.03
R1356:Abca12 UTSW 1 71302953 splice site probably benign
R1372:Abca12 UTSW 1 71294857 missense probably damaging 1.00
R1434:Abca12 UTSW 1 71309800 missense probably benign 0.00
R1580:Abca12 UTSW 1 71265965 missense possibly damaging 0.65
R1675:Abca12 UTSW 1 71263411 critical splice donor site probably null
R1773:Abca12 UTSW 1 71288596 missense probably damaging 1.00
R1829:Abca12 UTSW 1 71295029 missense probably benign 0.26
R1922:Abca12 UTSW 1 71319924 missense probably benign 0.10
R1927:Abca12 UTSW 1 71244840 missense probably damaging 1.00
R2115:Abca12 UTSW 1 71244771 missense probably benign 0.01
R2146:Abca12 UTSW 1 71263488 missense probably benign 0.02
R2148:Abca12 UTSW 1 71263488 missense probably benign 0.02
R2149:Abca12 UTSW 1 71263488 missense probably benign 0.02
R2150:Abca12 UTSW 1 71263488 missense probably benign 0.02
R2299:Abca12 UTSW 1 71258222 missense probably damaging 1.00
R2392:Abca12 UTSW 1 71258105 missense probably damaging 1.00
R2571:Abca12 UTSW 1 71249885 missense probably benign 0.00
R3077:Abca12 UTSW 1 71267605 missense probably benign 0.02
R3078:Abca12 UTSW 1 71267605 missense probably benign 0.02
R3705:Abca12 UTSW 1 71285705 missense probably damaging 1.00
R3800:Abca12 UTSW 1 71265887 missense probably damaging 1.00
R3905:Abca12 UTSW 1 71268230 missense possibly damaging 0.79
R3905:Abca12 UTSW 1 71279457 missense probably benign 0.02
R3962:Abca12 UTSW 1 71274515 splice site probably null
R4082:Abca12 UTSW 1 71267463 missense possibly damaging 0.64
R4131:Abca12 UTSW 1 71319871 critical splice donor site probably null
R4214:Abca12 UTSW 1 71288697 missense probably damaging 0.99
R4403:Abca12 UTSW 1 71267436 missense probably damaging 1.00
R4524:Abca12 UTSW 1 71302917 missense probably benign 0.19
R4615:Abca12 UTSW 1 71330334 missense probably benign
R4617:Abca12 UTSW 1 71330334 missense probably benign
R4714:Abca12 UTSW 1 71321450 missense probably benign 0.00
R4809:Abca12 UTSW 1 71278856 missense probably benign 0.10
R4810:Abca12 UTSW 1 71303612 missense probably benign 0.00
R4825:Abca12 UTSW 1 71302685 missense possibly damaging 0.70
R4990:Abca12 UTSW 1 71294939 missense possibly damaging 0.61
R5013:Abca12 UTSW 1 71264767 missense probably damaging 0.99
R5026:Abca12 UTSW 1 71317224 missense probably benign 0.04
R5064:Abca12 UTSW 1 71300960 missense probably damaging 1.00
R5188:Abca12 UTSW 1 71291492 missense probably benign 0.23
R5234:Abca12 UTSW 1 71263664 missense probably damaging 0.99
R5267:Abca12 UTSW 1 71335774 splice site probably benign
R5302:Abca12 UTSW 1 71283952 missense possibly damaging 0.91
R5441:Abca12 UTSW 1 71295056 missense probably damaging 1.00
R5451:Abca12 UTSW 1 71294917 missense possibly damaging 0.94
R5526:Abca12 UTSW 1 71292446 missense probably benign 0.29
R5529:Abca12 UTSW 1 71264881 missense probably damaging 1.00
R5615:Abca12 UTSW 1 71307059 missense probably damaging 1.00
R5649:Abca12 UTSW 1 71291342 missense probably damaging 1.00
R5800:Abca12 UTSW 1 71321432 missense possibly damaging 0.78
R5807:Abca12 UTSW 1 71303492 missense probably damaging 1.00
R5878:Abca12 UTSW 1 71346633 missense possibly damaging 0.79
R5987:Abca12 UTSW 1 71258098 missense probably damaging 1.00
R6280:Abca12 UTSW 1 71272460 missense probably benign 0.04
R6316:Abca12 UTSW 1 71313959 missense probably benign 0.01
R6337:Abca12 UTSW 1 71295013 missense probably damaging 1.00
R6564:Abca12 UTSW 1 71309850 missense possibly damaging 0.57
R6582:Abca12 UTSW 1 71258225 missense probably benign 0.00
R6756:Abca12 UTSW 1 71259353 splice site probably null
R6876:Abca12 UTSW 1 71263508 missense probably damaging 0.98
R6999:Abca12 UTSW 1 71317162 nonsense probably null
R7145:Abca12 UTSW 1 71307053 missense possibly damaging 0.92
R7272:Abca12 UTSW 1 71248432 missense probably damaging 0.99
R7285:Abca12 UTSW 1 71349155 nonsense probably null
R7421:Abca12 UTSW 1 71247136 nonsense probably null
R7531:Abca12 UTSW 1 71247173 missense probably damaging 0.99
R7592:Abca12 UTSW 1 71288677 missense probably benign 0.01
R7687:Abca12 UTSW 1 71258182 missense probably benign 0.00
R7690:Abca12 UTSW 1 71314154 missense probably benign 0.00
R7709:Abca12 UTSW 1 71335728 missense probably benign 0.00
R7736:Abca12 UTSW 1 71319964 missense probably benign 0.01
R7754:Abca12 UTSW 1 71302887 missense probably benign
R7761:Abca12 UTSW 1 71330288 missense probably damaging 1.00
R7816:Abca12 UTSW 1 71292429 missense probably benign 0.01
R7821:Abca12 UTSW 1 71259791 missense probably benign 0.12
R7827:Abca12 UTSW 1 71414678 start gained probably benign
R7829:Abca12 UTSW 1 71292421 missense probably benign 0.37
R7863:Abca12 UTSW 1 71293497 missense probably damaging 0.96
R7946:Abca12 UTSW 1 71293497 missense probably damaging 0.96
R8053:Abca12 UTSW 1 71349169 nonsense probably null
X0013:Abca12 UTSW 1 71248433 missense probably damaging 0.99
X0018:Abca12 UTSW 1 71314510 missense probably benign
X0063:Abca12 UTSW 1 71349064 missense probably benign 0.15
X0065:Abca12 UTSW 1 71341461 critical splice donor site probably null
Z1176:Abca12 UTSW 1 71284070 missense not run
Z1177:Abca12 UTSW 1 71276082 missense not run
Z1177:Abca12 UTSW 1 71282811 missense not run
Z1177:Abca12 UTSW 1 71292531 missense not run
Predicted Primers PCR Primer
(F):5'- TTCCCTAATGTATGCATGTTGC -3'
(R):5'- GCACATCCTGAACTTTTATGGCC -3'

Sequencing Primer
(F):5'- GCATGTTGCTATTATTACACTGGAAG -3'
(R):5'- CTTTTATGGCCAAATGACAGCC -3'
Posted On2018-05-04