Mutagenetix > Incidental Mutations

Incidental Mutation 'R6383:Cubn'

515408

Institutional Source

Beutler Lab

Gene Symbol

Cubn

Ensembl Gene

ENSMUSG00000026726

Gene Name

cubilin (intrinsic factor-cobalamin receptor)

Synonyms

D2Wsu88e

MMRRC Submission

Accession Numbers

Genbank: NM_001081084; MGI: 1931256

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R6383 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

13276338-13491813 bp(-) (GRCm38)

Type of Mutation

critical splice donor site (2 bp from exon)

DNA Base Change (assembly)

A to C at 13427835 bp

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000089009 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000091436]

Predicted Effect

probably null
Transcript: ENSMUST00000091436

SMART Domains

Protein: ENSMUSP00000089009
Gene: ENSMUSG00000026726

Domain	Start	End	E-Value	Type
signal peptide	1	20	N/A	INTRINSIC
EGF	132	165	2.14e-5	SMART
EGF_CA	167	208	1.95e-8	SMART
EGF	213	258	2.85e-1	SMART
EGF_CA	260	301	2.66e-10	SMART
EGF_CA	302	345	7.07e-6	SMART
EGF	349	393	1.01e-1	SMART
EGF	398	430	3.73e-5	SMART
EGF_CA	432	468	8.63e-10	SMART
CUB	474	586	4.4e-21	SMART
CUB	590	702	3.82e-39	SMART
CUB	708	816	3.66e-18	SMART
CUB	817	928	3.09e-25	SMART
CUB	932	1042	1.29e-36	SMART
CUB	1048	1161	3.46e-37	SMART
CUB	1165	1277	7.24e-40	SMART
CUB	1278	1389	8.33e-31	SMART
CUB	1391	1506	3.08e-43	SMART
CUB	1510	1619	1.9e-34	SMART
CUB	1620	1734	7.24e-40	SMART
CUB	1738	1850	6.02e-37	SMART
CUB	1852	1963	1.57e-26	SMART
CUB	1978	2091	3.46e-28	SMART
CUB	2092	2213	2.88e-34	SMART
CUB	2217	2334	4.13e-35	SMART
CUB	2336	2448	3.1e-39	SMART
CUB	2452	2565	5.37e-34	SMART
CUB	2570	2687	3e-23	SMART
CUB	2689	2801	3.1e-39	SMART
CUB	2805	2919	2.36e-21	SMART
CUB	2920	3035	6.18e-25	SMART
CUB	3037	3150	5.16e-36	SMART
CUB	3157	3274	1.68e-35	SMART
CUB	3278	3393	7.17e-12	SMART
CUB	3395	3507	2.49e-29	SMART
CUB	3511	3623	2.4e-22	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000195447

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.4%
20x: 97.9%

Validation Efficiency

97% (73/75)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Cubilin (CUBN) acts as a receptor for intrinsic factor-vitamin B12 complexes. The role of receptor is supported by the presence of 27 CUB domains. Cubulin is located within the epithelium of intestine and kidney. Mutations in CUBN may play a role in autosomal recessive megaloblastic anemia. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a null mutation display embryonic lethality during organogenesis, yolk sac and allantoic vasculature defects, embryonic and visceral endoderm defects, and lack somites. Heterozygotes display incomplete penetrance of premature death. [provided by MGI curators]

Allele List at MGI

All alleles(4) : Targeted, other(1) Gene trapped(3)

Other mutations in this stock

Total: 76 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abca12	A	T	1: 71,247,184	M2497K	probably benign	Het
Abtb2	C	T	2: 103,567,376	T217I	probably damaging	Het
Adam29	T	A	8: 55,871,508	N637I	probably damaging	Het
Adgb	T	A	10: 10,450,028	E59V	probably damaging	Het
Adh7	C	T	3: 138,228,017	R312C	probably benign	Het
Adprh	A	G	16: 38,447,452	I157T	probably damaging	Het
Ap2b1	T	C	11: 83,346,825	S572P	probably damaging	Het
Asic1	T	C	15: 99,698,880	L519P	probably damaging	Het
Atp2a2	G	C	5: 122,501,649	L13V	probably benign	Het
Bst2	A	T	8: 71,537,288	I47N	possibly damaging	Het
Cacng6	G	A	7: 3,424,993		probably null	Het
Cenpe	A	G	3: 135,251,528	E1849G	probably damaging	Het
Cep295	T	A	9: 15,332,754	T213S	probably damaging	Het
Chia1	A	G	3: 106,131,811	T406A	probably benign	Het
Chmp4c	G	T	3: 10,367,217	K62N	probably damaging	Het
Cldn15	A	G	5: 136,968,125	T7A	probably benign	Het
Cmpk2	T	A	12: 26,478,020	M412K	probably benign	Het
Cnnm1	T	C	19: 43,465,266		probably null	Het
Dopey2	T	C	16: 93,782,248	V1668A	possibly damaging	Het
Erg28	T	A	12: 85,816,429	Y77F	probably damaging	Het
F830045P16Rik	C	T	2: 129,536,438	A9T	probably benign	Het
Gli3	A	G	13: 15,723,555	D740G	probably damaging	Het
Gm13128	A	T	4: 144,333,147	*476L	probably null	Het
Gm14085	T	C	2: 122,524,807	I555T	probably benign	Het
Gpat2	G	C	2: 127,431,918	G294R	possibly damaging	Het
Gpat3	A	T	5: 100,893,144	M357L	probably benign	Het
Gpr179	A	G	11: 97,337,147	V1394A	possibly damaging	Het
Grn	T	A	11: 102,436,795		probably benign	Het
H2-Q6	G	A	17: 35,428,383		probably null	Het
Igsf3	A	G	3: 101,435,648	T514A	probably benign	Het
Il1r1	A	G	1: 40,313,335	D558G	possibly damaging	Het
Irx4	T	C	13: 73,267,713	M207T	possibly damaging	Het
Kap	T	C	6: 133,851,957	I54V	probably benign	Het
Kdm2b	G	A	5: 122,934,778	R340C	probably damaging	Het
Lipo3	T	A	19: 33,556,431	M334L	probably benign	Het
Lmbrd1	C	T	1: 24,706,034	L152F	probably damaging	Het
Ltbp1	G	A	17: 75,359,457	V1382I	probably damaging	Het
Map3k4	C	T	17: 12,249,583	D1008N	possibly damaging	Het
Mcf2l	T	C	8: 12,879,912		probably benign	Het
Mecom	T	G	3: 29,997,726	D180A	probably damaging	Het
Meis1	T	C	11: 18,941,741	D269G	probably benign	Het
Myh7	A	C	14: 54,988,894	S430A	probably benign	Het
Myo1h	A	G	5: 114,336,264	I439V	probably damaging	Het
Nat1	T	C	8: 67,491,482	V170A	possibly damaging	Het
Nlrp12	A	G	7: 3,234,043	L742P	probably damaging	Het
Nlrp4c	A	G	7: 6,066,053	T318A	probably benign	Het
Olfr1297	T	A	2: 111,621,186	N296I	probably benign	Het
Olfr1425	T	A	19: 12,074,363	I90F	probably damaging	Het
Olfr632	A	G	7: 103,937,823	I148V	probably benign	Het
Olfr952	G	T	9: 39,426,234	T279N	probably damaging	Het
Olfr955	A	T	9: 39,470,630	L32Q	probably damaging	Het
Otop3	A	G	11: 115,345,072	E529G	probably damaging	Het
Parp6	T	C	9: 59,623,939	Y35H	probably damaging	Het
Pcdhb4	A	C	18: 37,308,021	D128A	probably damaging	Het
Phldb2	C	T	16: 45,748,750	D1249N	probably damaging	Het
Ptpn12	T	A	5: 20,987,468	K765*	probably null	Het
Ptprb	T	A	10: 116,347,007	Y1529*	probably null	Het
Ptprc	A	T	1: 138,078,451	Y798N	possibly damaging	Het
Sdk2	G	A	11: 113,832,265	T1300I	probably damaging	Het
Sptbn2	G	A	19: 4,732,496	V487I	possibly damaging	Het
Sptbn5	A	G	2: 120,046,269		probably benign	Het
Srpk1	A	G	17: 28,590,062	S648P	probably damaging	Het
Stard9	T	C	2: 120,666,407		probably null	Het
Tmem135	A	T	7: 89,144,670	I388N	probably damaging	Het
Top3a	A	T	11: 60,749,459	I446N	probably benign	Het
Trpv1	T	C	11: 73,246,036	S482P	probably damaging	Het
Ugt3a1	C	T	15: 9,306,455	A230V	probably benign	Het
Vmn2r15	A	C	5: 109,293,226	Y255*	probably null	Het
Vmn2r60	A	G	7: 42,116,471	M1V	probably null	Het
Vmn2r87	A	G	10: 130,479,000	V239A	probably damaging	Het
Vwce	T	A	19: 10,659,592	C679*	probably null	Het
Zfp385b	C	T	2: 77,415,841	A281T	probably benign	Het
Zfp398	T	G	6: 47,866,595	L395W	probably damaging	Het
Zfp442	C	T	2: 150,451,401		probably null	Het
Zfp606	A	G	7: 12,492,944	S331G	probably benign	Het
Zfp882	A	G	8: 71,914,640	H437R	probably damaging	Het

Other mutations in Cubn

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00095:Cubn	APN	2	13491820	unclassified	probably benign
IGL00228:Cubn	APN	2	13456697	missense	probably damaging	1.00
IGL00231:Cubn	APN	2	13381849	missense	possibly damaging	0.89
IGL00327:Cubn	APN	2	13427056	missense	possibly damaging	0.73
IGL00470:Cubn	APN	2	13278418	missense	probably benign	0.00
IGL00519:Cubn	APN	2	13282919	missense	probably benign	0.00
IGL00562:Cubn	APN	2	13294230	missense	probably benign	0.01
IGL00678:Cubn	APN	2	13467710	missense	possibly damaging	0.47
IGL00834:Cubn	APN	2	13381927	missense	probably damaging	1.00
IGL00946:Cubn	APN	2	13456623	missense	probably damaging	0.98
IGL00971:Cubn	APN	2	13278408	missense	possibly damaging	0.77
IGL01124:Cubn	APN	2	13478093	missense	possibly damaging	0.62
IGL01287:Cubn	APN	2	13310566	missense	probably damaging	1.00
IGL01410:Cubn	APN	2	13465908	missense	probably benign	0.31
IGL01418:Cubn	APN	2	13284041	missense	probably benign	0.01
IGL01450:Cubn	APN	2	13350862	splice site	probably benign
IGL01534:Cubn	APN	2	13465933	nonsense	probably null
IGL01584:Cubn	APN	2	13308661	splice site	probably benign
IGL01595:Cubn	APN	2	13325216	missense	probably benign	0.05
IGL01625:Cubn	APN	2	13306274	missense	possibly damaging	0.76
IGL01732:Cubn	APN	2	13489936	nonsense	probably null
IGL01972:Cubn	APN	2	13446072	missense	possibly damaging	0.90
IGL02027:Cubn	APN	2	13287594	missense	probably damaging	1.00
IGL02033:Cubn	APN	2	13339846	missense	probably damaging	0.98
IGL02124:Cubn	APN	2	13381837	missense	probably damaging	0.99
IGL02335:Cubn	APN	2	13427834	splice site	probably null
IGL02491:Cubn	APN	2	13321228	missense	probably damaging	1.00
IGL02686:Cubn	APN	2	13325226	missense	possibly damaging	0.92
IGL02707:Cubn	APN	2	13446032	missense	probably damaging	0.99
IGL02746:Cubn	APN	2	13445040	missense	probably damaging	1.00
IGL02873:Cubn	APN	2	13294370	missense	probably benign	0.07
IGL02897:Cubn	APN	2	13318312	missense	possibly damaging	0.55
IGL03078:Cubn	APN	2	13287094	missense	possibly damaging	0.87
IGL03245:Cubn	APN	2	13355689	missense	probably benign	0.09
IGL03289:Cubn	APN	2	13426967	missense	probably benign	0.00
IGL03335:Cubn	APN	2	13360329	missense	probably damaging	1.00
IGL03355:Cubn	APN	2	13478057	splice site	probably null
mellow	UTSW	2	13478078	missense	probably damaging	1.00
PIT4354001:Cubn	UTSW	2	13468852	nonsense	probably null
PIT4495001:Cubn	UTSW	2	13491750	missense	probably benign	0.00
R0145:Cubn	UTSW	2	13306432	missense	probably damaging	1.00
R0220:Cubn	UTSW	2	13356709	missense	probably damaging	1.00
R0254:Cubn	UTSW	2	13424694	missense	probably benign	0.01
R0254:Cubn	UTSW	2	13440514	missense	possibly damaging	0.84
R0254:Cubn	UTSW	2	13476035	critical splice donor site	probably null
R0360:Cubn	UTSW	2	13310507	splice site	probably benign
R0364:Cubn	UTSW	2	13310507	splice site	probably benign
R0383:Cubn	UTSW	2	13430959	missense	probably damaging	1.00
R0419:Cubn	UTSW	2	13469763	missense	possibly damaging	0.77
R0419:Cubn	UTSW	2	13469764	missense	possibly damaging	0.87
R0498:Cubn	UTSW	2	13444267	missense	probably damaging	0.99
R0560:Cubn	UTSW	2	13428680	missense	probably damaging	1.00
R0615:Cubn	UTSW	2	13360252	splice site	probably null
R0735:Cubn	UTSW	2	13491689	splice site	probably benign
R0780:Cubn	UTSW	2	13456613	missense	probably damaging	1.00
R0899:Cubn	UTSW	2	13362328	missense	possibly damaging	0.54
R1118:Cubn	UTSW	2	13336242	missense	possibly damaging	0.78
R1182:Cubn	UTSW	2	13445000	missense	probably damaging	0.98
R1439:Cubn	UTSW	2	13287568	missense	probably damaging	0.96
R1450:Cubn	UTSW	2	13360319	missense	probably damaging	1.00
R1464:Cubn	UTSW	2	13325288	missense	possibly damaging	0.87
R1464:Cubn	UTSW	2	13325288	missense	possibly damaging	0.87
R1476:Cubn	UTSW	2	13476120	missense	probably benign	0.04
R1508:Cubn	UTSW	2	13427105	missense	probably benign	0.25
R1532:Cubn	UTSW	2	13287661	missense	probably damaging	1.00
R1562:Cubn	UTSW	2	13427967	missense	probably damaging	1.00
R1598:Cubn	UTSW	2	13469789	missense	probably benign	0.00
R1761:Cubn	UTSW	2	13489317	critical splice donor site	probably null
R1862:Cubn	UTSW	2	13308561	missense	probably damaging	1.00
R1874:Cubn	UTSW	2	13323002	missense	probably damaging	1.00
R1923:Cubn	UTSW	2	13310526	missense	probably damaging	1.00
R1944:Cubn	UTSW	2	13278538	missense	probably benign	0.01
R1960:Cubn	UTSW	2	13340017	splice site	probably null
R2021:Cubn	UTSW	2	13308549	missense	probably benign	0.09
R2137:Cubn	UTSW	2	13336167	missense	probably benign	0.01
R2138:Cubn	UTSW	2	13444378	missense	probably damaging	0.99
R2139:Cubn	UTSW	2	13336167	missense	probably benign	0.01
R2179:Cubn	UTSW	2	13318242	missense	possibly damaging	0.85
R2328:Cubn	UTSW	2	13404080	nonsense	probably null
R2369:Cubn	UTSW	2	13491217	missense	probably damaging	1.00
R2428:Cubn	UTSW	2	13476150	missense	probably damaging	1.00
R2435:Cubn	UTSW	2	13318272	missense	probably damaging	1.00
R2567:Cubn	UTSW	2	13278356	splice site	probably null
R2850:Cubn	UTSW	2	13322953	missense	probably damaging	1.00
R2853:Cubn	UTSW	2	13430834	missense	probably benign	0.00
R2893:Cubn	UTSW	2	13358139	missense	possibly damaging	0.61
R3107:Cubn	UTSW	2	13362347	missense	possibly damaging	0.73
R3109:Cubn	UTSW	2	13362347	missense	possibly damaging	0.73
R3119:Cubn	UTSW	2	13358162	missense	possibly damaging	0.90
R3405:Cubn	UTSW	2	13333508	missense	probably benign	0.00
R3703:Cubn	UTSW	2	13350943	missense	probably damaging	1.00
R3704:Cubn	UTSW	2	13350943	missense	probably damaging	1.00
R3705:Cubn	UTSW	2	13350943	missense	probably damaging	1.00
R3764:Cubn	UTSW	2	13331585	missense	possibly damaging	0.79
R3792:Cubn	UTSW	2	13427914	missense	probably damaging	1.00
R3802:Cubn	UTSW	2	13360353	missense	probably benign	0.01
R3813:Cubn	UTSW	2	13294325	missense	probably damaging	1.00
R3845:Cubn	UTSW	2	13283008	missense	probably damaging	1.00
R3846:Cubn	UTSW	2	13283008	missense	probably damaging	1.00
R3900:Cubn	UTSW	2	13286980	critical splice donor site	probably null
R3921:Cubn	UTSW	2	13326677	missense	probably damaging	1.00
R4075:Cubn	UTSW	2	13313999	missense	possibly damaging	0.58
R4082:Cubn	UTSW	2	13428563	intron	probably benign
R4405:Cubn	UTSW	2	13466030	missense	probably damaging	1.00
R4615:Cubn	UTSW	2	13428749	missense	probably damaging	1.00
R4629:Cubn	UTSW	2	13313979	splice site	probably null
R4770:Cubn	UTSW	2	13314767	missense	possibly damaging	0.92
R4799:Cubn	UTSW	2	13287024	missense	possibly damaging	0.94
R4799:Cubn	UTSW	2	13351058	missense	probably damaging	1.00
R4812:Cubn	UTSW	2	13459076	missense	probably damaging	1.00
R4825:Cubn	UTSW	2	13325225	missense	probably damaging	1.00
R4934:Cubn	UTSW	2	13489910	missense	probably benign	0.06
R4967:Cubn	UTSW	2	13348045	missense	probably benign	0.01
R5187:Cubn	UTSW	2	13287568	missense	probably damaging	0.96
R5232:Cubn	UTSW	2	13478202	nonsense	probably null
R5305:Cubn	UTSW	2	13388939	missense	probably damaging	1.00
R5506:Cubn	UTSW	2	13491695	splice site	probably null
R5530:Cubn	UTSW	2	13308523	missense	probably damaging	1.00
R5531:Cubn	UTSW	2	13350932	missense	probably benign	0.00
R5737:Cubn	UTSW	2	13388891	missense	probably damaging	1.00
R5886:Cubn	UTSW	2	13320023	splice site	probably benign
R5923:Cubn	UTSW	2	13486078	missense	possibly damaging	0.73
R6032:Cubn	UTSW	2	13325184	missense	probably benign	0.12
R6032:Cubn	UTSW	2	13325184	missense	probably benign	0.12
R6084:Cubn	UTSW	2	13430897	missense	probably damaging	1.00
R6087:Cubn	UTSW	2	13427847	missense	probably damaging	1.00
R6133:Cubn	UTSW	2	13308618	missense	probably benign	0.29
R6181:Cubn	UTSW	2	13349876	missense	probably benign	0.31
R6301:Cubn	UTSW	2	13478078	missense	probably damaging	1.00
R6320:Cubn	UTSW	2	13280195	missense	probably damaging	1.00
R6368:Cubn	UTSW	2	13430995	missense	probably damaging	0.96
R6368:Cubn	UTSW	2	13476123	missense	probably damaging	0.98
R6393:Cubn	UTSW	2	13355680	missense	probably benign	0.08
R6408:Cubn	UTSW	2	13294203	missense	probably damaging	1.00
R6470:Cubn	UTSW	2	13322993	missense	possibly damaging	0.87
R6532:Cubn	UTSW	2	13459002	missense	probably benign	0.01
R6599:Cubn	UTSW	2	13310673	missense	possibly damaging	0.95
R6629:Cubn	UTSW	2	13430872	missense	probably damaging	1.00
R6641:Cubn	UTSW	2	13476064	missense	probably damaging	1.00
R6800:Cubn	UTSW	2	13321255	missense	probably damaging	1.00
R6823:Cubn	UTSW	2	13445029	missense	probably benign	0.21
R6847:Cubn	UTSW	2	13444253	critical splice donor site	probably null
R6885:Cubn	UTSW	2	13318278	missense	probably damaging	1.00
R6962:Cubn	UTSW	2	13348029	missense	probably benign	0.03
R6973:Cubn	UTSW	2	13381837	missense	possibly damaging	0.61
R6975:Cubn	UTSW	2	13486789	missense	probably damaging	0.99
R7076:Cubn	UTSW	2	13306280	missense	probably benign	0.00
R7076:Cubn	UTSW	2	13306281	missense	probably benign	0.10
R7086:Cubn	UTSW	2	13319858	missense	probably damaging	0.98
R7162:Cubn	UTSW	2	13342498	missense	probably damaging	0.96
R7203:Cubn	UTSW	2	13351003	missense	probably benign	0.01
R7292:Cubn	UTSW	2	13424739	missense	probably damaging	0.99
R7307:Cubn	UTSW	2	13340332	missense	probably damaging	0.99
R7329:Cubn	UTSW	2	13468771	missense	probably damaging	0.99
R7395:Cubn	UTSW	2	13287064	missense	probably damaging	1.00
R7417:Cubn	UTSW	2	13426967	missense	probably benign	0.00
R7429:Cubn	UTSW	2	13322993	missense	possibly damaging	0.87
R7430:Cubn	UTSW	2	13322993	missense	possibly damaging	0.87
R7443:Cubn	UTSW	2	13455509	missense	probably damaging	1.00
R7699:Cubn	UTSW	2	13348178	missense	probably benign
R7699:Cubn	UTSW	2	13489917	missense	possibly damaging	0.74
R7700:Cubn	UTSW	2	13348178	missense	probably benign
R7700:Cubn	UTSW	2	13489917	missense	possibly damaging	0.74
R7751:Cubn	UTSW	2	13360365	missense	probably damaging	1.00
R7755:Cubn	UTSW	2	13280078	missense	probably benign	0.11
R7759:Cubn	UTSW	2	13348150	missense	probably damaging	1.00
R7903:Cubn	UTSW	2	13468869	missense	probably damaging	0.97
R7921:Cubn	UTSW	2	13424727	missense	probably benign	0.22
R7988:Cubn	UTSW	2	13332355	missense	probably benign	0.43
R8010:Cubn	UTSW	2	13336086	critical splice donor site	probably null
R8020:Cubn	UTSW	2	13479178	missense	probably benign	0.01
R8120:Cubn	UTSW	2	13331660	missense	probably damaging	1.00
R8133:Cubn	UTSW	2	13388848	missense	probably damaging	1.00
R8185:Cubn	UTSW	2	13294318	missense	probably benign	0.11
R8224:Cubn	UTSW	2	13349877	missense	probably benign	0.16
R8289:Cubn	UTSW	2	13486802	missense	probably benign	0.10
R8326:Cubn	UTSW	2	13306463	missense	probably benign	0.01
R8331:Cubn	UTSW	2	13340242	missense	probably damaging	1.00
R8338:Cubn	UTSW	2	13430847	missense	probably benign	0.08
R8341:Cubn	UTSW	2	13428724	missense	probably damaging	1.00
R8358:Cubn	UTSW	2	13325160	missense	probably benign	0.17
R8427:Cubn	UTSW	2	13428756	missense	probably benign	0.00
R8432:Cubn	UTSW	2	13381799	missense	probably benign	0.00
R8441:Cubn	UTSW	2	13427847	missense	probably damaging	1.00
R8442:Cubn	UTSW	2	13314044	missense	probably damaging	1.00
R8520:Cubn	UTSW	2	13308520	critical splice donor site	probably null
X0018:Cubn	UTSW	2	13458986	missense	probably damaging	1.00
X0022:Cubn	UTSW	2	13476076	missense	probably damaging	1.00
X0026:Cubn	UTSW	2	13342581	missense	probably damaging	1.00
X0063:Cubn	UTSW	2	13322962	missense	probably damaging	1.00
YA93:Cubn	UTSW	2	13383992	missense	probably benign	0.21
Z1088:Cubn	UTSW	2	13294229	missense	probably benign	0.43
Z1176:Cubn	UTSW	2	13381825	missense	probably damaging	0.99

Predicted Primers

PCR Primer
(F):5'- GGATAAAGTCCATAACTCCTCAGC -3'
(R):5'- TGTGGAGGCAATCTCACCAC -3'

Sequencing Primer
(F):5'- AGTCCATAACTCCTCAGCATATG -3'
(R):5'- TCTCACCACCCCCACAGG -3'

Posted On

2018-05-04