Mutagenetix > Incidental Mutation

Incidental Mutation 'R6383:Stard9'

515413

Institutional Source

Beutler Lab

Gene Symbol

Stard9

Ensembl Gene

ENSMUSG00000033705

Gene Name

START domain containing 9

Synonyms

E230025N21Rik, Kif16a, 4831403C07Rik, N-3 kinesin

MMRRC Submission

044532-MU

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.158) question?

Stock #

R6383 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

120629121-120731895 bp(+) (GRCm38)

Type of Mutation

critical splice donor site (2 bp from exon)

DNA Base Change (assembly)

T to C at 120666407 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000136055 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000140843] [ENSMUST00000150912] [ENSMUST00000180041]

AlphaFold

no structure available at present

Predicted Effect

probably benign
Transcript: ENSMUST00000140843

SMART Domains

Protein: ENSMUSP00000117178
Gene: ENSMUSG00000033705

Domain	Start	End	E-Value	Type
FHA	63	115	2.8e-4	SMART
coiled coil region	334	354	N/A	INTRINSIC
low complexity region	573	584	N/A	INTRINSIC
low complexity region	866	871	N/A	INTRINSIC
low complexity region	1023	1035	N/A	INTRINSIC
low complexity region	1234	1248	N/A	INTRINSIC
low complexity region	1765	1775	N/A	INTRINSIC
low complexity region	2546	2559	N/A	INTRINSIC
low complexity region	2953	2963	N/A	INTRINSIC
low complexity region	3269	3281	N/A	INTRINSIC
low complexity region	3421	3435	N/A	INTRINSIC
coiled coil region	3767	3808	N/A	INTRINSIC
low complexity region	3812	3821	N/A	INTRINSIC
low complexity region	3827	3844	N/A	INTRINSIC
low complexity region	3904	3925	N/A	INTRINSIC
SCOP:d1jssa_	3946	4142	1e-28	SMART
Blast:START	3947	4143	1e-10	BLAST

Predicted Effect

probably null
Transcript: ENSMUST00000150912

SMART Domains

Protein: ENSMUSP00000121874
Gene: ENSMUSG00000033705

Domain	Start	End	E-Value	Type
KISc	1	392	3.31e-143	SMART
low complexity region	398	409	N/A	INTRINSIC

Predicted Effect

probably null
Transcript: ENSMUST00000180041

SMART Domains

Protein: ENSMUSP00000136055
Gene: ENSMUSG00000033705

Domain	Start	End	E-Value	Type
KISc	1	392	3.31e-143	SMART
low complexity region	398	409	N/A	INTRINSIC
FHA	481	533	2.8e-4	SMART
coiled coil region	752	772	N/A	INTRINSIC
low complexity region	991	1002	N/A	INTRINSIC
low complexity region	1284	1289	N/A	INTRINSIC
low complexity region	1441	1453	N/A	INTRINSIC
low complexity region	1652	1666	N/A	INTRINSIC
low complexity region	2183	2193	N/A	INTRINSIC
low complexity region	2964	2977	N/A	INTRINSIC
low complexity region	3371	3381	N/A	INTRINSIC
low complexity region	3687	3699	N/A	INTRINSIC
low complexity region	3839	3853	N/A	INTRINSIC
coiled coil region	4185	4226	N/A	INTRINSIC
low complexity region	4230	4239	N/A	INTRINSIC
low complexity region	4245	4262	N/A	INTRINSIC
low complexity region	4322	4343	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000229722

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.4%
20x: 97.9%

Validation Efficiency

97% (73/75)

Allele List at MGI

Other mutations in this stock

Total: 76 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abca12	A	T	1: 71,247,184	M2497K	probably benign	Het
Abtb2	C	T	2: 103,567,376	T217I	probably damaging	Het
Adam29	T	A	8: 55,871,508	N637I	probably damaging	Het
Adgb	T	A	10: 10,450,028	E59V	probably damaging	Het
Adh7	C	T	3: 138,228,017	R312C	probably benign	Het
Adprh	A	G	16: 38,447,452	I157T	probably damaging	Het
Ap2b1	T	C	11: 83,346,825	S572P	probably damaging	Het
Asic1	T	C	15: 99,698,880	L519P	probably damaging	Het
Atp2a2	G	C	5: 122,501,649	L13V	probably benign	Het
Bst2	A	T	8: 71,537,288	I47N	possibly damaging	Het
Cacng6	G	A	7: 3,424,993		probably null	Het
Cenpe	A	G	3: 135,251,528	E1849G	probably damaging	Het
Cep295	T	A	9: 15,332,754	T213S	probably damaging	Het
Chia1	A	G	3: 106,131,811	T406A	probably benign	Het
Chmp4c	G	T	3: 10,367,217	K62N	probably damaging	Het
Cldn15	A	G	5: 136,968,125	T7A	probably benign	Het
Cmpk2	T	A	12: 26,478,020	M412K	probably benign	Het
Cnnm1	T	C	19: 43,465,266		probably null	Het
Cubn	A	C	2: 13,427,835		probably null	Het
Dopey2	T	C	16: 93,782,248	V1668A	possibly damaging	Het
Erg28	T	A	12: 85,816,429	Y77F	probably damaging	Het
F830045P16Rik	C	T	2: 129,536,438	A9T	probably benign	Het
Gli3	A	G	13: 15,723,555	D740G	probably damaging	Het
Gm13128	A	T	4: 144,333,147	*476L	probably null	Het
Gm14085	T	C	2: 122,524,807	I555T	probably benign	Het
Gpat2	G	C	2: 127,431,918	G294R	possibly damaging	Het
Gpat3	A	T	5: 100,893,144	M357L	probably benign	Het
Gpr179	A	G	11: 97,337,147	V1394A	possibly damaging	Het
Grn	T	A	11: 102,436,795		probably benign	Het
H2-Q6	G	A	17: 35,428,383		probably null	Het
Igsf3	A	G	3: 101,435,648	T514A	probably benign	Het
Il1r1	A	G	1: 40,313,335	D558G	possibly damaging	Het
Irx4	T	C	13: 73,267,713	M207T	possibly damaging	Het
Kap	T	C	6: 133,851,957	I54V	probably benign	Het
Kdm2b	G	A	5: 122,934,778	R340C	probably damaging	Het
Lipo3	T	A	19: 33,556,431	M334L	probably benign	Het
Lmbrd1	C	T	1: 24,706,034	L152F	probably damaging	Het
Ltbp1	G	A	17: 75,359,457	V1382I	probably damaging	Het
Map3k4	C	T	17: 12,249,583	D1008N	possibly damaging	Het
Mcf2l	T	C	8: 12,879,912		probably benign	Het
Mecom	T	G	3: 29,997,726	D180A	probably damaging	Het
Meis1	T	C	11: 18,941,741	D269G	probably benign	Het
Myh7	A	C	14: 54,988,894	S430A	probably benign	Het
Myo1h	A	G	5: 114,336,264	I439V	probably damaging	Het
Nat1	T	C	8: 67,491,482	V170A	possibly damaging	Het
Nlrp12	A	G	7: 3,234,043	L742P	probably damaging	Het
Nlrp4c	A	G	7: 6,066,053	T318A	probably benign	Het
Olfr1297	T	A	2: 111,621,186	N296I	probably benign	Het
Olfr1425	T	A	19: 12,074,363	I90F	probably damaging	Het
Olfr632	A	G	7: 103,937,823	I148V	probably benign	Het
Olfr952	G	T	9: 39,426,234	T279N	probably damaging	Het
Olfr955	A	T	9: 39,470,630	L32Q	probably damaging	Het
Otop3	A	G	11: 115,345,072	E529G	probably damaging	Het
Parp6	T	C	9: 59,623,939	Y35H	probably damaging	Het
Pcdhb4	A	C	18: 37,308,021	D128A	probably damaging	Het
Phldb2	C	T	16: 45,748,750	D1249N	probably damaging	Het
Ptpn12	T	A	5: 20,987,468	K765*	probably null	Het
Ptprb	T	A	10: 116,347,007	Y1529*	probably null	Het
Ptprc	A	T	1: 138,078,451	Y798N	possibly damaging	Het
Sdk2	G	A	11: 113,832,265	T1300I	probably damaging	Het
Sptbn2	G	A	19: 4,732,496	V487I	possibly damaging	Het
Sptbn5	A	G	2: 120,046,269		probably benign	Het
Srpk1	A	G	17: 28,590,062	S648P	probably damaging	Het
Tmem135	A	T	7: 89,144,670	I388N	probably damaging	Het
Top3a	A	T	11: 60,749,459	I446N	probably benign	Het
Trpv1	T	C	11: 73,246,036	S482P	probably damaging	Het
Ugt3a1	C	T	15: 9,306,455	A230V	probably benign	Het
Vmn2r15	A	C	5: 109,293,226	Y255*	probably null	Het
Vmn2r60	A	G	7: 42,116,471	M1V	probably null	Het
Vmn2r87	A	G	10: 130,479,000	V239A	probably damaging	Het
Vwce	T	A	19: 10,659,592	C679*	probably null	Het
Zfp385b	C	T	2: 77,415,841	A281T	probably benign	Het
Zfp398	T	G	6: 47,866,595	L395W	probably damaging	Het
Zfp442	C	T	2: 150,451,401		probably null	Het
Zfp606	A	G	7: 12,492,944	S331G	probably benign	Het
Zfp882	A	G	8: 71,914,640	H437R	probably damaging	Het

Other mutations in Stard9

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01103:Stard9	APN	2	120701847	missense	possibly damaging	0.52
IGL01122:Stard9	APN	2	120698479	missense	possibly damaging	0.93
IGL01318:Stard9	APN	2	120698719	missense	possibly damaging	0.56
IGL01371:Stard9	APN	2	120701368	missense	probably benign	0.04
IGL01394:Stard9	APN	2	120706327	missense	possibly damaging	0.78
IGL01531:Stard9	APN	2	120673604	missense	possibly damaging	0.93
IGL01721:Stard9	APN	2	120703330	missense	probably damaging	1.00
IGL01810:Stard9	APN	2	120699084	missense	possibly damaging	0.95
IGL01829:Stard9	APN	2	120706446	missense	possibly damaging	0.59
IGL01916:Stard9	APN	2	120668016	missense	probably damaging	1.00
IGL02031:Stard9	APN	2	120702339	missense	probably benign	0.27
IGL02081:Stard9	APN	2	120664910	missense	probably damaging	0.98
IGL02558:Stard9	APN	2	120696907	missense	possibly damaging	0.95
IGL02646:Stard9	APN	2	120698992	missense	probably damaging	1.00
IGL02873:Stard9	APN	2	120713807	missense	probably damaging	1.00
IGL03195:Stard9	APN	2	120705802	missense	probably damaging	1.00
IGL03204:Stard9	APN	2	120705802	missense	probably damaging	1.00
FR4737:Stard9	UTSW	2	120696085	small insertion	probably benign
IGL03014:Stard9	UTSW	2	120702194	unclassified	probably benign
PIT4151001:Stard9	UTSW	2	120702756	nonsense	probably null
PIT4498001:Stard9	UTSW	2	120697435	missense	possibly damaging	0.86
R0027:Stard9	UTSW	2	120703501	missense	probably benign
R0027:Stard9	UTSW	2	120703501	missense	probably benign
R0038:Stard9	UTSW	2	120695832	missense	probably benign
R0049:Stard9	UTSW	2	120699819	missense	probably damaging	1.00
R0049:Stard9	UTSW	2	120699819	missense	probably damaging	1.00
R0116:Stard9	UTSW	2	120634255	missense	probably damaging	0.99
R0398:Stard9	UTSW	2	120696307	missense	probably benign	0.03
R0479:Stard9	UTSW	2	120697596	missense	probably damaging	1.00
R0556:Stard9	UTSW	2	120698923	missense	probably benign	0.09
R0589:Stard9	UTSW	2	120698547	missense	probably benign	0.00
R0609:Stard9	UTSW	2	120706306	missense	probably damaging	1.00
R0611:Stard9	UTSW	2	120699257	missense	probably benign	0.00
R0683:Stard9	UTSW	2	120673636	missense	probably damaging	1.00
R0751:Stard9	UTSW	2	120697485	missense	probably benign	0.04
R0833:Stard9	UTSW	2	120696999	missense	possibly damaging	0.86
R0836:Stard9	UTSW	2	120696999	missense	possibly damaging	0.86
R0838:Stard9	UTSW	2	120700842	missense	probably damaging	1.00
R0848:Stard9	UTSW	2	120695823	missense	probably damaging	1.00
R0849:Stard9	UTSW	2	120673636	missense	probably damaging	1.00
R0961:Stard9	UTSW	2	120693439	missense	probably benign	0.01
R0993:Stard9	UTSW	2	120705169	missense	probably damaging	1.00
R1005:Stard9	UTSW	2	120673636	missense	probably damaging	1.00
R1006:Stard9	UTSW	2	120673636	missense	probably damaging	1.00
R1115:Stard9	UTSW	2	120692850	missense	probably benign	0.05
R1163:Stard9	UTSW	2	120696213	missense	possibly damaging	0.86
R1199:Stard9	UTSW	2	120673636	missense	probably damaging	1.00
R1200:Stard9	UTSW	2	120673636	missense	probably damaging	1.00
R1331:Stard9	UTSW	2	120673636	missense	probably damaging	1.00
R1332:Stard9	UTSW	2	120673636	missense	probably damaging	1.00
R1333:Stard9	UTSW	2	120673636	missense	probably damaging	1.00
R1334:Stard9	UTSW	2	120673636	missense	probably damaging	1.00
R1335:Stard9	UTSW	2	120673636	missense	probably damaging	1.00
R1336:Stard9	UTSW	2	120673636	missense	probably damaging	1.00
R1338:Stard9	UTSW	2	120673636	missense	probably damaging	1.00
R1346:Stard9	UTSW	2	120713448	missense	probably damaging	1.00
R1370:Stard9	UTSW	2	120697477	missense	probably benign	0.11
R1384:Stard9	UTSW	2	120673636	missense	probably damaging	1.00
R1401:Stard9	UTSW	2	120712847	splice site	probably benign
R1416:Stard9	UTSW	2	120700972	missense	probably benign	0.00
R1453:Stard9	UTSW	2	120666376	missense	probably damaging	1.00
R1468:Stard9	UTSW	2	120703197	missense	possibly damaging	0.90
R1468:Stard9	UTSW	2	120703197	missense	possibly damaging	0.90
R1525:Stard9	UTSW	2	120702052	missense	probably benign	0.09
R1538:Stard9	UTSW	2	120696711	missense	probably benign	0.25
R1614:Stard9	UTSW	2	120697675	missense	possibly damaging	0.95
R1654:Stard9	UTSW	2	120703722	missense	probably benign	0.37
R1658:Stard9	UTSW	2	120701542	missense	probably benign	0.02
R1686:Stard9	UTSW	2	120699492	missense	probably benign	0.00
R1797:Stard9	UTSW	2	120673636	missense	probably damaging	1.00
R1803:Stard9	UTSW	2	120701489	missense	probably benign	0.24
R1806:Stard9	UTSW	2	120679453	splice site	probably null
R1847:Stard9	UTSW	2	120698489	missense	possibly damaging	0.51
R1853:Stard9	UTSW	2	120688751	missense	probably damaging	1.00
R1892:Stard9	UTSW	2	120693708	missense	probably benign	0.01
R1906:Stard9	UTSW	2	120696427	missense	probably benign	0.00
R1907:Stard9	UTSW	2	120713812	missense	probably damaging	1.00
R1930:Stard9	UTSW	2	120673636	missense	probably damaging	1.00
R1933:Stard9	UTSW	2	120698656	missense	possibly damaging	0.55
R1989:Stard9	UTSW	2	120701406	missense	probably benign
R1999:Stard9	UTSW	2	120692868	missense	probably damaging	0.99
R2004:Stard9	UTSW	2	120673636	missense	probably damaging	1.00
R2005:Stard9	UTSW	2	120664945	missense	possibly damaging	0.90
R2005:Stard9	UTSW	2	120673636	missense	probably damaging	1.00
R2021:Stard9	UTSW	2	120704235	missense	probably benign	0.05
R2025:Stard9	UTSW	2	120702398	missense	probably benign	0.20
R2190:Stard9	UTSW	2	120714120	missense	probably benign	0.22
R2204:Stard9	UTSW	2	120698531	frame shift	probably null
R2422:Stard9	UTSW	2	120700284	missense	probably benign	0.29
R3401:Stard9	UTSW	2	120703689	missense	probably damaging	0.98
R3618:Stard9	UTSW	2	120699019	missense	possibly damaging	0.49
R3619:Stard9	UTSW	2	120699019	missense	possibly damaging	0.49
R3900:Stard9	UTSW	2	120713549	missense	possibly damaging	0.93
R3943:Stard9	UTSW	2	120698229	missense	probably benign	0.11
R4022:Stard9	UTSW	2	120704155	missense	probably benign	0.05
R4223:Stard9	UTSW	2	120664991	missense	possibly damaging	0.95
R4224:Stard9	UTSW	2	120664991	missense	possibly damaging	0.95
R4225:Stard9	UTSW	2	120664991	missense	possibly damaging	0.95
R4345:Stard9	UTSW	2	120701946	missense	probably benign	0.43
R4382:Stard9	UTSW	2	120634222	missense	probably damaging	1.00
R4453:Stard9	UTSW	2	120697791	missense	probably benign
R4499:Stard9	UTSW	2	120700241	missense	probably benign	0.05
R4524:Stard9	UTSW	2	120696445	missense	probably damaging	1.00
R4671:Stard9	UTSW	2	120698640	missense	probably damaging	0.98
R4701:Stard9	UTSW	2	120705713	missense	possibly damaging	0.85
R4744:Stard9	UTSW	2	120696123	missense	probably benign	0.01
R4822:Stard9	UTSW	2	120695941	missense	possibly damaging	0.94
R4847:Stard9	UTSW	2	120703113	missense	probably benign	0.18
R4863:Stard9	UTSW	2	120700860	missense	probably benign	0.00
R4898:Stard9	UTSW	2	120706419	nonsense	probably null
R5033:Stard9	UTSW	2	120693399	missense	probably benign	0.00
R5087:Stard9	UTSW	2	120697019	nonsense	probably null
R5157:Stard9	UTSW	2	120697861	missense	probably benign
R5213:Stard9	UTSW	2	120699226	missense	probably damaging	1.00
R5237:Stard9	UTSW	2	120699358	missense	probably damaging	0.96
R5257:Stard9	UTSW	2	120699343	missense	probably damaging	0.99
R5258:Stard9	UTSW	2	120699343	missense	probably damaging	0.99
R5273:Stard9	UTSW	2	120705087	missense	possibly damaging	0.94
R5286:Stard9	UTSW	2	120701947	missense	probably benign	0.43
R5288:Stard9	UTSW	2	120700630	missense	probably damaging	0.98
R5292:Stard9	UTSW	2	120699145	missense	probably benign	0.17
R5328:Stard9	UTSW	2	120699230	missense	probably damaging	1.00
R5385:Stard9	UTSW	2	120700630	missense	probably damaging	0.98
R5386:Stard9	UTSW	2	120700630	missense	probably damaging	0.98
R5393:Stard9	UTSW	2	120702906	missense	possibly damaging	0.87
R5405:Stard9	UTSW	2	120693668	missense	probably benign	0.17
R5685:Stard9	UTSW	2	120705322	missense	probably damaging	1.00
R5749:Stard9	UTSW	2	120703786	missense	probably damaging	1.00
R5780:Stard9	UTSW	2	120703396	missense	probably benign	0.02
R5901:Stard9	UTSW	2	120701370	missense	probably damaging	1.00
R5941:Stard9	UTSW	2	120713558	missense	probably damaging	1.00
R5960:Stard9	UTSW	2	120699961	missense	probably benign	0.05
R5966:Stard9	UTSW	2	120697099	missense	probably damaging	1.00
R5967:Stard9	UTSW	2	120706894	missense	probably damaging	0.99
R6012:Stard9	UTSW	2	120704586	missense	probably damaging	1.00
R6019:Stard9	UTSW	2	120693715	frame shift	probably null
R6020:Stard9	UTSW	2	120693715	frame shift	probably null
R6036:Stard9	UTSW	2	120700075	missense	probably benign	0.09
R6036:Stard9	UTSW	2	120700075	missense	probably benign	0.09
R6090:Stard9	UTSW	2	120693654	missense	probably damaging	0.99
R6192:Stard9	UTSW	2	120696760	missense	probably damaging	0.99
R6228:Stard9	UTSW	2	120713750	missense	probably damaging	1.00
R6235:Stard9	UTSW	2	120713546	missense	probably damaging	1.00
R6280:Stard9	UTSW	2	120701127	missense	probably benign
R6338:Stard9	UTSW	2	120697485	missense	probably benign
R6344:Stard9	UTSW	2	120704320	missense	probably benign	0.12
R6364:Stard9	UTSW	2	120713429	missense	probably damaging	1.00
R6644:Stard9	UTSW	2	120695772	missense	probably benign	0.11
R6747:Stard9	UTSW	2	120698383	missense	possibly damaging	0.62
R6833:Stard9	UTSW	2	120701259	missense	probably damaging	1.00
R6836:Stard9	UTSW	2	120699843	missense	probably benign	0.15
R6861:Stard9	UTSW	2	120705186	missense	probably benign	0.09
R6872:Stard9	UTSW	2	120714068	nonsense	probably null
R6875:Stard9	UTSW	2	120697436	missense	probably benign	0.04
R6915:Stard9	UTSW	2	120702630	missense	probably benign	0.00
R6934:Stard9	UTSW	2	120697695	missense	probably benign	0.00
R6943:Stard9	UTSW	2	120702196	missense	probably benign	0.29
R7009:Stard9	UTSW	2	120697191	missense	probably benign	0.37
R7031:Stard9	UTSW	2	120700450	missense	possibly damaging	0.61
R7132:Stard9	UTSW	2	120679378	nonsense	probably null
R7151:Stard9	UTSW	2	120696142	missense	probably benign
R7154:Stard9	UTSW	2	120701314	missense	probably benign	0.00
R7154:Stard9	UTSW	2	120704542	missense	probably benign	0.02
R7165:Stard9	UTSW	2	120704158	missense	probably damaging	1.00
R7260:Stard9	UTSW	2	120706938	missense	possibly damaging	0.90
R7270:Stard9	UTSW	2	120634274	nonsense	probably null
R7282:Stard9	UTSW	2	120698503	missense	probably benign	0.00
R7344:Stard9	UTSW	2	120704686	missense	possibly damaging	0.90
R7347:Stard9	UTSW	2	120666534	missense	probably benign
R7359:Stard9	UTSW	2	120698280	missense	probably damaging	1.00
R7375:Stard9	UTSW	2	120665002	splice site	probably null
R7410:Stard9	UTSW	2	120701497	missense	probably benign	0.41
R7422:Stard9	UTSW	2	120702152	missense	probably benign	0.21
R7475:Stard9	UTSW	2	120688110	missense	probably damaging	1.00
R7523:Stard9	UTSW	2	120699597	missense	probably benign
R7553:Stard9	UTSW	2	120693808	splice site	probably null
R7624:Stard9	UTSW	2	120688146	missense	probably benign	0.15
R7761:Stard9	UTSW	2	120699379	missense	probably benign	0.00
R7794:Stard9	UTSW	2	120704430	missense	probably benign	0.01
R7819:Stard9	UTSW	2	120700984	missense	probably damaging	1.00
R7823:Stard9	UTSW	2	120702106	missense	probably damaging	0.96
R7837:Stard9	UTSW	2	120703665	missense	probably benign	0.06
R7889:Stard9	UTSW	2	120704461	missense	probably benign	0.11
R7905:Stard9	UTSW	2	120696081	missense	not run
R7956:Stard9	UTSW	2	120705371	nonsense	probably null
R8013:Stard9	UTSW	2	120688101	missense	probably damaging	1.00
R8113:Stard9	UTSW	2	120704430	missense	probably benign	0.01
R8114:Stard9	UTSW	2	120704430	missense	probably benign	0.01
R8116:Stard9	UTSW	2	120664939	nonsense	probably null
R8117:Stard9	UTSW	2	120704430	missense	probably benign	0.01
R8118:Stard9	UTSW	2	120704430	missense	probably benign	0.01
R8170:Stard9	UTSW	2	120700048	missense	possibly damaging	0.76
R8300:Stard9	UTSW	2	120704769	missense	possibly damaging	0.71
R8333:Stard9	UTSW	2	120701789	missense	probably benign	0.00
R8337:Stard9	UTSW	2	120679825	missense	probably damaging	1.00
R8536:Stard9	UTSW	2	120714659	missense	possibly damaging	0.93
R8682:Stard9	UTSW	2	120703315	missense	possibly damaging	0.65
R8696:Stard9	UTSW	2	120701114	missense	probably benign	0.02
R8708:Stard9	UTSW	2	120703578	missense	probably damaging	1.00
R8732:Stard9	UTSW	2	120679961	missense	probably damaging	1.00
R8798:Stard9	UTSW	2	120704731	missense	probably benign	0.09
R8807:Stard9	UTSW	2	120705451	missense	probably damaging	1.00
R8807:Stard9	UTSW	2	120705462	missense	probably damaging	1.00
R8862:Stard9	UTSW	2	120703618	missense	probably benign
R8920:Stard9	UTSW	2	120702607	missense	probably damaging	0.96
R9026:Stard9	UTSW	2	120705802	missense	probably damaging	1.00
R9048:Stard9	UTSW	2	120677934	missense	probably damaging	0.99
R9049:Stard9	UTSW	2	120679937	missense	probably benign	0.30
R9152:Stard9	UTSW	2	120698587	missense	probably damaging	0.99
R9189:Stard9	UTSW	2	120703019	missense	possibly damaging	0.95
R9238:Stard9	UTSW	2	120697966	missense	probably damaging	1.00
R9372:Stard9	UTSW	2	120664939	nonsense	probably null
R9393:Stard9	UTSW	2	120688175	missense	possibly damaging	0.88
R9444:Stard9	UTSW	2	120664933	missense	probably damaging	1.00
R9514:Stard9	UTSW	2	120704083	missense	probably damaging	1.00
R9515:Stard9	UTSW	2	120704083	missense	probably damaging	1.00
R9516:Stard9	UTSW	2	120704083	missense	probably damaging	1.00
R9570:Stard9	UTSW	2	120704233	missense	probably benign	0.02
R9649:Stard9	UTSW	2	120696154	missense	probably benign	0.20
R9789:Stard9	UTSW	2	120679936	missense	probably damaging	1.00
X0023:Stard9	UTSW	2	120702744	missense	probably benign	0.00
X0023:Stard9	UTSW	2	120702963	missense	possibly damaging	0.92
Z1176:Stard9	UTSW	2	120695818	missense	probably benign	0.01
Z1176:Stard9	UTSW	2	120696612	missense	probably benign
Z1176:Stard9	UTSW	2	120698322	missense	probably damaging	1.00
Z1177:Stard9	UTSW	2	120673676	critical splice donor site	probably null

Predicted Primers

PCR Primer
(F):5'- TGCCAGCAAGTAGTCTTCTATAC -3'
(R):5'- TGACCCTGACGTGAAAGGAG -3'

Sequencing Primer
(F):5'- ATACACTGCTGTATAGGCTAGCTCG -3'
(R):5'- CCTGACGTGAAAGGAGCTGGG -3'

Posted On

2018-05-04