Incidental Mutation 'R6383:Chia1'
ID515421
Institutional Source Beutler Lab
Gene Symbol Chia1
Ensembl Gene ENSMUSG00000062778
Gene Namechitinase, acidic 1
Synonyms2200003E03Rik, YNL, AMCase, Chia
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.470) question?
Stock #R6383 (G1)
Quality Score193.009
Status Validated
Chromosome3
Chromosomal Location106113229-106132120 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 106131811 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 406 (T406A)
Ref Sequence ENSEMBL: ENSMUSP00000078134 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000079132] [ENSMUST00000139086]
Predicted Effect probably benign
Transcript: ENSMUST00000079132
AA Change: T406A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000078134
Gene: ENSMUSG00000062778
AA Change: T406A

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
Glyco_18 22 365 1.82e-161 SMART
ChtBD2 425 473 2.06e-6 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000139086
SMART Domains Protein: ENSMUSP00000121967
Gene: ENSMUSG00000062778

DomainStartEndE-ValueType
Glyco_18 3 215 2.24e-47 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000143128
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 97.9%
Validation Efficiency 97% (73/75)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene degrades chitin, which is found in the cell wall of most fungi as well as in arthropods and some nematodes. The encoded protein can also stimulate interleukin 13 expression, and variations in this gene can lead to asthma susceptibility. Several transcript variants encoding a few different isoforms have been found for this gene. [provided by RefSeq, Apr 2012]
Allele List at MGI
Other mutations in this stock
Total: 76 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca12 A T 1: 71,247,184 M2497K probably benign Het
Abtb2 C T 2: 103,567,376 T217I probably damaging Het
Adam29 T A 8: 55,871,508 N637I probably damaging Het
Adgb T A 10: 10,450,028 E59V probably damaging Het
Adh7 C T 3: 138,228,017 R312C probably benign Het
Adprh A G 16: 38,447,452 I157T probably damaging Het
Ap2b1 T C 11: 83,346,825 S572P probably damaging Het
Asic1 T C 15: 99,698,880 L519P probably damaging Het
Atp2a2 G C 5: 122,501,649 L13V probably benign Het
Bst2 A T 8: 71,537,288 I47N possibly damaging Het
Cacng6 G A 7: 3,424,993 probably null Het
Cenpe A G 3: 135,251,528 E1849G probably damaging Het
Cep295 T A 9: 15,332,754 T213S probably damaging Het
Chmp4c G T 3: 10,367,217 K62N probably damaging Het
Cldn15 A G 5: 136,968,125 T7A probably benign Het
Cmpk2 T A 12: 26,478,020 M412K probably benign Het
Cnnm1 T C 19: 43,465,266 probably null Het
Cubn A C 2: 13,427,835 probably null Het
Dopey2 T C 16: 93,782,248 V1668A possibly damaging Het
Erg28 T A 12: 85,816,429 Y77F probably damaging Het
F830045P16Rik C T 2: 129,536,438 A9T probably benign Het
Gli3 A G 13: 15,723,555 D740G probably damaging Het
Gm13128 A T 4: 144,333,147 *476L probably null Het
Gm14085 T C 2: 122,524,807 I555T probably benign Het
Gpat2 G C 2: 127,431,918 G294R possibly damaging Het
Gpat3 A T 5: 100,893,144 M357L probably benign Het
Gpr179 A G 11: 97,337,147 V1394A possibly damaging Het
Grn T A 11: 102,436,795 probably benign Het
H2-Q6 G A 17: 35,428,383 probably null Het
Igsf3 A G 3: 101,435,648 T514A probably benign Het
Il1r1 A G 1: 40,313,335 D558G possibly damaging Het
Irx4 T C 13: 73,267,713 M207T possibly damaging Het
Kap T C 6: 133,851,957 I54V probably benign Het
Kdm2b G A 5: 122,934,778 R340C probably damaging Het
Lipo3 T A 19: 33,556,431 M334L probably benign Het
Lmbrd1 C T 1: 24,706,034 L152F probably damaging Het
Ltbp1 G A 17: 75,359,457 V1382I probably damaging Het
Map3k4 C T 17: 12,249,583 D1008N possibly damaging Het
Mcf2l T C 8: 12,879,912 probably benign Het
Mecom T G 3: 29,997,726 D180A probably damaging Het
Meis1 T C 11: 18,941,741 D269G probably benign Het
Myh7 A C 14: 54,988,894 S430A probably benign Het
Myo1h A G 5: 114,336,264 I439V probably damaging Het
Nat1 T C 8: 67,491,482 V170A possibly damaging Het
Nlrp12 A G 7: 3,234,043 L742P probably damaging Het
Nlrp4c A G 7: 6,066,053 T318A probably benign Het
Olfr1297 T A 2: 111,621,186 N296I probably benign Het
Olfr1425 T A 19: 12,074,363 I90F probably damaging Het
Olfr632 A G 7: 103,937,823 I148V probably benign Het
Olfr952 G T 9: 39,426,234 T279N probably damaging Het
Olfr955 A T 9: 39,470,630 L32Q probably damaging Het
Otop3 A G 11: 115,345,072 E529G probably damaging Het
Parp6 T C 9: 59,623,939 Y35H probably damaging Het
Pcdhb4 A C 18: 37,308,021 D128A probably damaging Het
Phldb2 C T 16: 45,748,750 D1249N probably damaging Het
Ptpn12 T A 5: 20,987,468 K765* probably null Het
Ptprb T A 10: 116,347,007 Y1529* probably null Het
Ptprc A T 1: 138,078,451 Y798N possibly damaging Het
Sdk2 G A 11: 113,832,265 T1300I probably damaging Het
Sptbn2 G A 19: 4,732,496 V487I possibly damaging Het
Sptbn5 A G 2: 120,046,269 probably benign Het
Srpk1 A G 17: 28,590,062 S648P probably damaging Het
Stard9 T C 2: 120,666,407 probably null Het
Tmem135 A T 7: 89,144,670 I388N probably damaging Het
Top3a A T 11: 60,749,459 I446N probably benign Het
Trpv1 T C 11: 73,246,036 S482P probably damaging Het
Ugt3a1 C T 15: 9,306,455 A230V probably benign Het
Vmn2r15 A C 5: 109,293,226 Y255* probably null Het
Vmn2r60 A G 7: 42,116,471 M1V probably null Het
Vmn2r87 A G 10: 130,479,000 V239A probably damaging Het
Vwce T A 19: 10,659,592 C679* probably null Het
Zfp385b C T 2: 77,415,841 A281T probably benign Het
Zfp398 T G 6: 47,866,595 L395W probably damaging Het
Zfp442 C T 2: 150,451,401 probably null Het
Zfp606 A G 7: 12,492,944 S331G probably benign Het
Zfp882 A G 8: 71,914,640 H437R probably damaging Het
Other mutations in Chia1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01917:Chia1 APN 3 106128220 missense probably damaging 1.00
R0004:Chia1 UTSW 3 106129009 missense probably damaging 1.00
R0011:Chia1 UTSW 3 106130974 unclassified probably benign
R0047:Chia1 UTSW 3 106115257 missense probably damaging 0.99
R0345:Chia1 UTSW 3 106122439 missense probably damaging 1.00
R0456:Chia1 UTSW 3 106128479 missense probably damaging 1.00
R0638:Chia1 UTSW 3 106128437 splice site probably benign
R0847:Chia1 UTSW 3 106131937 missense probably benign 0.12
R1055:Chia1 UTSW 3 106130883 missense probably damaging 1.00
R1401:Chia1 UTSW 3 106128939 missense probably benign 0.00
R1513:Chia1 UTSW 3 106131904 missense probably benign 0.44
R1846:Chia1 UTSW 3 106130865 missense probably damaging 0.98
R1882:Chia1 UTSW 3 106128474 missense probably damaging 1.00
R1914:Chia1 UTSW 3 106128559 missense probably benign 0.06
R1915:Chia1 UTSW 3 106128559 missense probably benign 0.06
R2107:Chia1 UTSW 3 106128840 nonsense probably null
R3969:Chia1 UTSW 3 106121635 splice site probably null
R3970:Chia1 UTSW 3 106121635 splice site probably null
R4112:Chia1 UTSW 3 106128528 missense probably damaging 1.00
R4432:Chia1 UTSW 3 106115325 missense probably benign 0.03
R4625:Chia1 UTSW 3 106128940 missense probably benign 0.00
R4748:Chia1 UTSW 3 106122449 missense probably damaging 1.00
R5805:Chia1 UTSW 3 106128476 missense probably damaging 0.98
R5906:Chia1 UTSW 3 106131988 missense probably benign 0.01
R6173:Chia1 UTSW 3 106129022 critical splice donor site probably null
R6214:Chia1 UTSW 3 106122445 missense probably damaging 1.00
R6215:Chia1 UTSW 3 106122445 missense probably damaging 1.00
R6225:Chia1 UTSW 3 106130897 missense possibly damaging 0.66
R6423:Chia1 UTSW 3 106128988 missense possibly damaging 0.60
R6668:Chia1 UTSW 3 106130948 missense probably damaging 1.00
R6764:Chia1 UTSW 3 106130740 critical splice donor site probably null
R7030:Chia1 UTSW 3 106115325 missense probably damaging 1.00
R7221:Chia1 UTSW 3 106131920 missense probably damaging 1.00
R7265:Chia1 UTSW 3 106128923 missense probably damaging 1.00
R7343:Chia1 UTSW 3 106132015 makesense probably null
R7420:Chia1 UTSW 3 106130664 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- AGTTCCTGCTATGTCTTACAGC -3'
(R):5'- GAATGGCATTAGGTTCATGGCC -3'

Sequencing Primer
(F):5'- ACAGCCTCTTCAGTTGTGAGACTG -3'
(R):5'- TGGCCAGTTGCAGCAATTAC -3'
Posted On2018-05-04