Incidental Mutation 'R6383:Myo1h'
ID515428
Institutional Source Beutler Lab
Gene Symbol Myo1h
Ensembl Gene ENSMUSG00000066952
Gene Namemyosin 1H
Synonyms4631401O15Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6383 (G1)
Quality Score194.009
Status Validated
Chromosome5
Chromosomal Location114289166-114365357 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 114336264 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Valine at position 439 (I439V)
Ref Sequence ENSEMBL: ENSMUSP00000144110 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000124316] [ENSMUST00000169347] [ENSMUST00000202006]
Predicted Effect probably damaging
Transcript: ENSMUST00000124316
AA Change: I439V

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000118824
Gene: ENSMUSG00000066952
AA Change: I439V

DomainStartEndE-ValueType
MYSc 5 692 N/A SMART
IQ 693 715 1.21e1 SMART
IQ 716 738 6.6e-2 SMART
Pfam:Myosin_TH1 833 1015 5.8e-34 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000169347
AA Change: I455V

PolyPhen 2 Score 0.223 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000132905
Gene: ENSMUSG00000066952
AA Change: I455V

DomainStartEndE-ValueType
MYSc 5 692 N/A SMART
IQ 693 715 1.21e1 SMART
IQ 716 738 6.6e-2 SMART
Pfam:Myosin_TH1 834 1013 2.3e-28 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000202006
AA Change: I439V

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000144110
Gene: ENSMUSG00000066952
AA Change: I439V

DomainStartEndE-ValueType
MYSc 5 692 N/A SMART
IQ 693 715 1.21e1 SMART
IQ 716 738 6.6e-2 SMART
Pfam:Myosin_TH1 834 1013 2.3e-28 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 97.9%
Validation Efficiency 97% (73/75)
Allele List at MGI
Other mutations in this stock
Total: 76 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca12 A T 1: 71,247,184 M2497K probably benign Het
Abtb2 C T 2: 103,567,376 T217I probably damaging Het
Adam29 T A 8: 55,871,508 N637I probably damaging Het
Adgb T A 10: 10,450,028 E59V probably damaging Het
Adh7 C T 3: 138,228,017 R312C probably benign Het
Adprh A G 16: 38,447,452 I157T probably damaging Het
Ap2b1 T C 11: 83,346,825 S572P probably damaging Het
Asic1 T C 15: 99,698,880 L519P probably damaging Het
Atp2a2 G C 5: 122,501,649 L13V probably benign Het
Bst2 A T 8: 71,537,288 I47N possibly damaging Het
Cacng6 G A 7: 3,424,993 probably null Het
Cenpe A G 3: 135,251,528 E1849G probably damaging Het
Cep295 T A 9: 15,332,754 T213S probably damaging Het
Chia1 A G 3: 106,131,811 T406A probably benign Het
Chmp4c G T 3: 10,367,217 K62N probably damaging Het
Cldn15 A G 5: 136,968,125 T7A probably benign Het
Cmpk2 T A 12: 26,478,020 M412K probably benign Het
Cnnm1 T C 19: 43,465,266 probably null Het
Cubn A C 2: 13,427,835 probably null Het
Dopey2 T C 16: 93,782,248 V1668A possibly damaging Het
Erg28 T A 12: 85,816,429 Y77F probably damaging Het
F830045P16Rik C T 2: 129,536,438 A9T probably benign Het
Gli3 A G 13: 15,723,555 D740G probably damaging Het
Gm13128 A T 4: 144,333,147 *476L probably null Het
Gm14085 T C 2: 122,524,807 I555T probably benign Het
Gpat2 G C 2: 127,431,918 G294R possibly damaging Het
Gpat3 A T 5: 100,893,144 M357L probably benign Het
Gpr179 A G 11: 97,337,147 V1394A possibly damaging Het
Grn T A 11: 102,436,795 probably benign Het
H2-Q6 G A 17: 35,428,383 probably null Het
Igsf3 A G 3: 101,435,648 T514A probably benign Het
Il1r1 A G 1: 40,313,335 D558G possibly damaging Het
Irx4 T C 13: 73,267,713 M207T possibly damaging Het
Kap T C 6: 133,851,957 I54V probably benign Het
Kdm2b G A 5: 122,934,778 R340C probably damaging Het
Lipo3 T A 19: 33,556,431 M334L probably benign Het
Lmbrd1 C T 1: 24,706,034 L152F probably damaging Het
Ltbp1 G A 17: 75,359,457 V1382I probably damaging Het
Map3k4 C T 17: 12,249,583 D1008N possibly damaging Het
Mcf2l T C 8: 12,879,912 probably benign Het
Mecom T G 3: 29,997,726 D180A probably damaging Het
Meis1 T C 11: 18,941,741 D269G probably benign Het
Myh7 A C 14: 54,988,894 S430A probably benign Het
Nat1 T C 8: 67,491,482 V170A possibly damaging Het
Nlrp12 A G 7: 3,234,043 L742P probably damaging Het
Nlrp4c A G 7: 6,066,053 T318A probably benign Het
Olfr1297 T A 2: 111,621,186 N296I probably benign Het
Olfr1425 T A 19: 12,074,363 I90F probably damaging Het
Olfr632 A G 7: 103,937,823 I148V probably benign Het
Olfr952 G T 9: 39,426,234 T279N probably damaging Het
Olfr955 A T 9: 39,470,630 L32Q probably damaging Het
Otop3 A G 11: 115,345,072 E529G probably damaging Het
Parp6 T C 9: 59,623,939 Y35H probably damaging Het
Pcdhb4 A C 18: 37,308,021 D128A probably damaging Het
Phldb2 C T 16: 45,748,750 D1249N probably damaging Het
Ptpn12 T A 5: 20,987,468 K765* probably null Het
Ptprb T A 10: 116,347,007 Y1529* probably null Het
Ptprc A T 1: 138,078,451 Y798N possibly damaging Het
Sdk2 G A 11: 113,832,265 T1300I probably damaging Het
Sptbn2 G A 19: 4,732,496 V487I possibly damaging Het
Sptbn5 A G 2: 120,046,269 probably benign Het
Srpk1 A G 17: 28,590,062 S648P probably damaging Het
Stard9 T C 2: 120,666,407 probably null Het
Tmem135 A T 7: 89,144,670 I388N probably damaging Het
Top3a A T 11: 60,749,459 I446N probably benign Het
Trpv1 T C 11: 73,246,036 S482P probably damaging Het
Ugt3a1 C T 15: 9,306,455 A230V probably benign Het
Vmn2r15 A C 5: 109,293,226 Y255* probably null Het
Vmn2r60 A G 7: 42,116,471 M1V probably null Het
Vmn2r87 A G 10: 130,479,000 V239A probably damaging Het
Vwce T A 19: 10,659,592 C679* probably null Het
Zfp385b C T 2: 77,415,841 A281T probably benign Het
Zfp398 T G 6: 47,866,595 L395W probably damaging Het
Zfp442 C T 2: 150,451,401 probably null Het
Zfp606 A G 7: 12,492,944 S331G probably benign Het
Zfp882 A G 8: 71,914,640 H437R probably damaging Het
Other mutations in Myo1h
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00850:Myo1h APN 5 114315071 splice site probably benign
IGL00922:Myo1h APN 5 114360485 missense probably damaging 1.00
IGL01022:Myo1h APN 5 114336300 missense possibly damaging 0.67
IGL01364:Myo1h APN 5 114348439 missense probably damaging 1.00
IGL01469:Myo1h APN 5 114361269 missense probably damaging 1.00
IGL01626:Myo1h APN 5 114314966 missense probably damaging 1.00
IGL02026:Myo1h APN 5 114323444 missense probably null 0.07
IGL02156:Myo1h APN 5 114353911 splice site probably benign
IGL02164:Myo1h APN 5 114334096 missense probably damaging 1.00
IGL02429:Myo1h APN 5 114359738 splice site probably benign
IGL02562:Myo1h APN 5 114357992 missense probably benign 0.06
IGL02938:Myo1h APN 5 114358939 missense probably damaging 1.00
R0056:Myo1h UTSW 5 114330212 missense probably damaging 1.00
R0172:Myo1h UTSW 5 114329164 splice site probably null
R0346:Myo1h UTSW 5 114355209 missense probably benign 0.19
R0464:Myo1h UTSW 5 114360510 missense probably damaging 1.00
R0556:Myo1h UTSW 5 114319791 missense probably damaging 1.00
R0723:Myo1h UTSW 5 114319680 missense probably benign 0.20
R0751:Myo1h UTSW 5 114320686 missense probably damaging 1.00
R1470:Myo1h UTSW 5 114319704 missense probably damaging 0.99
R1470:Myo1h UTSW 5 114319704 missense probably damaging 0.99
R1579:Myo1h UTSW 5 114347435 nonsense probably null
R1646:Myo1h UTSW 5 114317632 missense possibly damaging 0.90
R1648:Myo1h UTSW 5 114336275 missense probably damaging 1.00
R1981:Myo1h UTSW 5 114353837 missense probably damaging 1.00
R2006:Myo1h UTSW 5 114361079 missense probably damaging 1.00
R2697:Myo1h UTSW 5 114355213 missense probably damaging 1.00
R3124:Myo1h UTSW 5 114328799 missense probably benign 0.04
R3195:Myo1h UTSW 5 114328740 missense probably benign
R4255:Myo1h UTSW 5 114330137 missense possibly damaging 0.89
R4613:Myo1h UTSW 5 114348379 missense possibly damaging 0.73
R4613:Myo1h UTSW 5 114351676 missense probably benign 0.02
R4758:Myo1h UTSW 5 114349582 missense probably damaging 1.00
R4784:Myo1h UTSW 5 114360599 missense possibly damaging 0.46
R4785:Myo1h UTSW 5 114360599 missense possibly damaging 0.46
R5511:Myo1h UTSW 5 114345897 nonsense probably null
R5663:Myo1h UTSW 5 114334094 missense probably damaging 1.00
R6186:Myo1h UTSW 5 114319803 missense possibly damaging 0.90
R6243:Myo1h UTSW 5 114362147 missense probably damaging 1.00
R6344:Myo1h UTSW 5 114328715 missense probably damaging 1.00
R6345:Myo1h UTSW 5 114351708 missense probably damaging 1.00
R6444:Myo1h UTSW 5 114314956 missense possibly damaging 0.63
R6787:Myo1h UTSW 5 114320653 missense probably damaging 1.00
R6891:Myo1h UTSW 5 114349612 missense probably damaging 1.00
R6990:Myo1h UTSW 5 114330160 missense probably damaging 0.97
R7040:Myo1h UTSW 5 114359744 missense possibly damaging 0.67
R7101:Myo1h UTSW 5 114342197 missense
R7121:Myo1h UTSW 5 114338229 missense
R7206:Myo1h UTSW 5 114319775 nonsense probably null
R7222:Myo1h UTSW 5 114355261 critical splice donor site probably null
R7921:Myo1h UTSW 5 114328811 splice site probably null
R7979:Myo1h UTSW 5 114336311 splice site probably null
R8004:Myo1h UTSW 5 114320708 missense
Z1177:Myo1h UTSW 5 114334156 missense
Predicted Primers PCR Primer
(F):5'- TAGATGGATGTATATAGACCAATGCA -3'
(R):5'- ACCCATGGCAATCGACCCT -3'

Sequencing Primer
(F):5'- TTTCAAATGCTATCCCAAAGTCC -3'
(R):5'- CCTCGTTGCTGGAGTTACACAG -3'
Posted On2018-05-04