Mutagenetix > Incidental Mutation

Incidental Mutation 'R6383:Vmn2r60'

515438

Institutional Source

Beutler Lab

Gene Symbol

Vmn2r60

Ensembl Gene

ENSMUSG00000090619

Gene Name

vomeronasal 2, receptor 60

Synonyms

Gprc2a-rs3, Casr-rs3, EG637898

MMRRC Submission

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.085) question?

Stock #

R6383 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

42116471-42195776 bp(+) (GRCm38)

Type of Mutation

start codon destroyed

DNA Base Change (assembly)

A to G at 42116471 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Methionine to Valine at position 1 (M1V)

Ref Sequence

ENSEMBL: ENSMUSP00000128493 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000166447]

AlphaFold

A0A3B2WBC8

Predicted Effect

probably null
Transcript: ENSMUST00000166447
AA Change: M1V

PolyPhen 2 Score 0.036 (Sensitivity: 0.94; Specificity: 0.82)

SMART Domains

Protein: ENSMUSP00000128493
Gene: ENSMUSG00000090619
AA Change: M1V

Domain	Start	End	E-Value	Type
signal peptide	1	18	N/A	INTRINSIC
Pfam:ANF_receptor	78	471	1.2e-44	PFAM
Pfam:NCD3G	514	567	5.1e-23	PFAM
Pfam:7tm_3	600	835	1.4e-51	PFAM

Meta Mutation Damage Score

0.9755

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.4%
20x: 97.9%

Validation Efficiency

97% (73/75)

Allele List at MGI

Other mutations in this stock

Total: 76 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abca12	A	T	1: 71,247,184	M2497K	probably benign	Het
Abtb2	C	T	2: 103,567,376	T217I	probably damaging	Het
Adam29	T	A	8: 55,871,508	N637I	probably damaging	Het
Adgb	T	A	10: 10,450,028	E59V	probably damaging	Het
Adh7	C	T	3: 138,228,017	R312C	probably benign	Het
Adprh	A	G	16: 38,447,452	I157T	probably damaging	Het
Ap2b1	T	C	11: 83,346,825	S572P	probably damaging	Het
Asic1	T	C	15: 99,698,880	L519P	probably damaging	Het
Atp2a2	G	C	5: 122,501,649	L13V	probably benign	Het
Bst2	A	T	8: 71,537,288	I47N	possibly damaging	Het
Cacng6	G	A	7: 3,424,993		probably null	Het
Cenpe	A	G	3: 135,251,528	E1849G	probably damaging	Het
Cep295	T	A	9: 15,332,754	T213S	probably damaging	Het
Chia1	A	G	3: 106,131,811	T406A	probably benign	Het
Chmp4c	G	T	3: 10,367,217	K62N	probably damaging	Het
Cldn15	A	G	5: 136,968,125	T7A	probably benign	Het
Cmpk2	T	A	12: 26,478,020	M412K	probably benign	Het
Cnnm1	T	C	19: 43,465,266		probably null	Het
Cubn	A	C	2: 13,427,835		probably null	Het
Dopey2	T	C	16: 93,782,248	V1668A	possibly damaging	Het
Erg28	T	A	12: 85,816,429	Y77F	probably damaging	Het
F830045P16Rik	C	T	2: 129,536,438	A9T	probably benign	Het
Gli3	A	G	13: 15,723,555	D740G	probably damaging	Het
Gm13128	A	T	4: 144,333,147	*476L	probably null	Het
Gm14085	T	C	2: 122,524,807	I555T	probably benign	Het
Gpat2	G	C	2: 127,431,918	G294R	possibly damaging	Het
Gpat3	A	T	5: 100,893,144	M357L	probably benign	Het
Gpr179	A	G	11: 97,337,147	V1394A	possibly damaging	Het
Grn	T	A	11: 102,436,795		probably benign	Het
H2-Q6	G	A	17: 35,428,383		probably null	Het
Igsf3	A	G	3: 101,435,648	T514A	probably benign	Het
Il1r1	A	G	1: 40,313,335	D558G	possibly damaging	Het
Irx4	T	C	13: 73,267,713	M207T	possibly damaging	Het
Kap	T	C	6: 133,851,957	I54V	probably benign	Het
Kdm2b	G	A	5: 122,934,778	R340C	probably damaging	Het
Lipo3	T	A	19: 33,556,431	M334L	probably benign	Het
Lmbrd1	C	T	1: 24,706,034	L152F	probably damaging	Het
Ltbp1	G	A	17: 75,359,457	V1382I	probably damaging	Het
Map3k4	C	T	17: 12,249,583	D1008N	possibly damaging	Het
Mcf2l	T	C	8: 12,879,912		probably benign	Het
Mecom	T	G	3: 29,997,726	D180A	probably damaging	Het
Meis1	T	C	11: 18,941,741	D269G	probably benign	Het
Myh7	A	C	14: 54,988,894	S430A	probably benign	Het
Myo1h	A	G	5: 114,336,264	I439V	probably damaging	Het
Nat1	T	C	8: 67,491,482	V170A	possibly damaging	Het
Nlrp12	A	G	7: 3,234,043	L742P	probably damaging	Het
Nlrp4c	A	G	7: 6,066,053	T318A	probably benign	Het
Olfr1297	T	A	2: 111,621,186	N296I	probably benign	Het
Olfr1425	T	A	19: 12,074,363	I90F	probably damaging	Het
Olfr632	A	G	7: 103,937,823	I148V	probably benign	Het
Olfr952	G	T	9: 39,426,234	T279N	probably damaging	Het
Olfr955	A	T	9: 39,470,630	L32Q	probably damaging	Het
Otop3	A	G	11: 115,345,072	E529G	probably damaging	Het
Parp6	T	C	9: 59,623,939	Y35H	probably damaging	Het
Pcdhb4	A	C	18: 37,308,021	D128A	probably damaging	Het
Phldb2	C	T	16: 45,748,750	D1249N	probably damaging	Het
Ptpn12	T	A	5: 20,987,468	K765*	probably null	Het
Ptprb	T	A	10: 116,347,007	Y1529*	probably null	Het
Ptprc	A	T	1: 138,078,451	Y798N	possibly damaging	Het
Sdk2	G	A	11: 113,832,265	T1300I	probably damaging	Het
Sptbn2	G	A	19: 4,732,496	V487I	possibly damaging	Het
Sptbn5	A	G	2: 120,046,269		probably benign	Het
Srpk1	A	G	17: 28,590,062	S648P	probably damaging	Het
Stard9	T	C	2: 120,666,407		probably null	Het
Tmem135	A	T	7: 89,144,670	I388N	probably damaging	Het
Top3a	A	T	11: 60,749,459	I446N	probably benign	Het
Trpv1	T	C	11: 73,246,036	S482P	probably damaging	Het
Ugt3a1	C	T	15: 9,306,455	A230V	probably benign	Het
Vmn2r15	A	C	5: 109,293,226	Y255*	probably null	Het
Vmn2r87	A	G	10: 130,479,000	V239A	probably damaging	Het
Vwce	T	A	19: 10,659,592	C679*	probably null	Het
Zfp385b	C	T	2: 77,415,841	A281T	probably benign	Het
Zfp398	T	G	6: 47,866,595	L395W	probably damaging	Het
Zfp442	C	T	2: 150,451,401		probably null	Het
Zfp606	A	G	7: 12,492,944	S331G	probably benign	Het
Zfp882	A	G	8: 71,914,640	H437R	probably damaging	Het

Other mutations in Vmn2r60

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01622:Vmn2r60	APN	7	42136486	missense	probably benign	0.09
IGL01623:Vmn2r60	APN	7	42136486	missense	probably benign	0.09
IGL02363:Vmn2r60	APN	7	42195154	missense	probably benign	0.02
IGL02485:Vmn2r60	APN	7	42195466	missense	possibly damaging	0.54
IGL02651:Vmn2r60	APN	7	42195586	missense	probably damaging	0.99
IGL02660:Vmn2r60	APN	7	42142296	nonsense	probably null
IGL03135:Vmn2r60	APN	7	42136594	missense	probably benign	0.13
IGL03307:Vmn2r60	APN	7	42116547	missense	probably benign	0.14
R0310:Vmn2r60	UTSW	7	42195140	missense	possibly damaging	0.54
R0314:Vmn2r60	UTSW	7	42135561	splice site	probably benign
R0328:Vmn2r60	UTSW	7	42142320	splice site	probably benign
R0464:Vmn2r60	UTSW	7	42135831	missense	probably damaging	0.99
R0755:Vmn2r60	UTSW	7	42195445	missense	probably damaging	1.00
R1119:Vmn2r60	UTSW	7	42194941	missense	possibly damaging	0.68
R1162:Vmn2r60	UTSW	7	42195771	missense	probably benign	0.29
R1241:Vmn2r60	UTSW	7	42137052	missense	probably benign	0.01
R1404:Vmn2r60	UTSW	7	42136787	missense	probably damaging	0.99
R1404:Vmn2r60	UTSW	7	42136787	missense	probably damaging	0.99
R1488:Vmn2r60	UTSW	7	42136713	missense	probably benign	0.17
R1623:Vmn2r60	UTSW	7	42135855	nonsense	probably null
R1628:Vmn2r60	UTSW	7	42136406	nonsense	probably null
R1883:Vmn2r60	UTSW	7	42136670	missense	probably damaging	0.99
R1884:Vmn2r60	UTSW	7	42136670	missense	probably damaging	0.99
R2182:Vmn2r60	UTSW	7	42195507	missense	probably benign	0.06
R2275:Vmn2r60	UTSW	7	42136827	nonsense	probably null
R2847:Vmn2r60	UTSW	7	42136433	missense	probably benign	0.07
R2885:Vmn2r60	UTSW	7	42140979	missense	possibly damaging	0.91
R2894:Vmn2r60	UTSW	7	42135796	missense	probably benign
R2921:Vmn2r60	UTSW	7	42141035	missense	probably damaging	0.98
R2922:Vmn2r60	UTSW	7	42141035	missense	probably damaging	0.98
R3772:Vmn2r60	UTSW	7	42116556	missense	probably benign	0.35
R3820:Vmn2r60	UTSW	7	42135701	missense	probably damaging	0.98
R3822:Vmn2r60	UTSW	7	42135701	missense	probably damaging	0.98
R3872:Vmn2r60	UTSW	7	42136454	missense	probably benign	0.19
R4222:Vmn2r60	UTSW	7	42116528	missense	probably benign	0.08
R4223:Vmn2r60	UTSW	7	42116528	missense	probably benign	0.08
R4224:Vmn2r60	UTSW	7	42116528	missense	probably benign	0.08
R4526:Vmn2r60	UTSW	7	42195243	missense	probably damaging	0.96
R4547:Vmn2r60	UTSW	7	42135663	missense	probably null	0.54
R4840:Vmn2r60	UTSW	7	42135861	missense	probably damaging	1.00
R5173:Vmn2r60	UTSW	7	42195511	missense	probably damaging	0.97
R5231:Vmn2r60	UTSW	7	42137024	missense	possibly damaging	0.93
R5480:Vmn2r60	UTSW	7	42135730	missense	probably damaging	0.98
R5521:Vmn2r60	UTSW	7	42195625	missense	probably damaging	0.99
R5834:Vmn2r60	UTSW	7	42116508	missense	probably benign	0.17
R6038:Vmn2r60	UTSW	7	42194962	missense	probably benign	0.04
R6038:Vmn2r60	UTSW	7	42194962	missense	probably benign	0.04
R6112:Vmn2r60	UTSW	7	42195423	missense	probably damaging	1.00
R6149:Vmn2r60	UTSW	7	42136976	missense	probably damaging	1.00
R6170:Vmn2r60	UTSW	7	42135621	missense	possibly damaging	0.94
R6811:Vmn2r60	UTSW	7	42194886	missense	probably damaging	1.00
R6876:Vmn2r60	UTSW	7	42135663	missense	probably null	0.54
R6997:Vmn2r60	UTSW	7	42142292	missense	probably benign	0.00
R7040:Vmn2r60	UTSW	7	42142242	missense	probably benign	0.00
R7116:Vmn2r60	UTSW	7	42137063	missense	probably benign	0.00
R7128:Vmn2r60	UTSW	7	42195112	missense	probably damaging	0.96
R7232:Vmn2r60	UTSW	7	42136742	missense	possibly damaging	0.83
R7296:Vmn2r60	UTSW	7	42136402	missense	probably benign	0.01
R7376:Vmn2r60	UTSW	7	42195207	missense	probably damaging	1.00
R7526:Vmn2r60	UTSW	7	42195734	frame shift	probably null
R7527:Vmn2r60	UTSW	7	42195734	frame shift	probably null
R7528:Vmn2r60	UTSW	7	42195734	frame shift	probably null
R7764:Vmn2r60	UTSW	7	42195111	missense	probably damaging	0.99
R7843:Vmn2r60	UTSW	7	42195087	missense	probably benign	0.00
R8080:Vmn2r60	UTSW	7	42141097	missense	probably benign	0.30
R8290:Vmn2r60	UTSW	7	42142266	missense	probably damaging	1.00
R8342:Vmn2r60	UTSW	7	42141070	missense	possibly damaging	0.63
R8362:Vmn2r60	UTSW	7	42195530	missense	probably damaging	1.00
R8418:Vmn2r60	UTSW	7	42195426	missense	probably damaging	0.97
R8848:Vmn2r60	UTSW	7	42136745	missense	probably damaging	1.00
R8860:Vmn2r60	UTSW	7	42142230	missense	probably damaging	0.99
R8882:Vmn2r60	UTSW	7	42141094	missense	probably benign	0.00
R8913:Vmn2r60	UTSW	7	42136354	missense	probably benign	0.27
R9190:Vmn2r60	UTSW	7	42195511	missense	probably damaging	0.99
R9229:Vmn2r60	UTSW	7	42142299	missense	possibly damaging	0.95
R9295:Vmn2r60	UTSW	7	42136531	missense	probably benign	0.01
R9335:Vmn2r60	UTSW	7	42194908	missense	probably damaging	1.00
R9796:Vmn2r60	UTSW	7	42135748	missense	probably benign
RF024:Vmn2r60	UTSW	7	42140939	missense	probably benign	0.01
X0023:Vmn2r60	UTSW	7	42141114	missense	probably benign	0.01

Predicted Primers

PCR Primer
(F):5'- AGAACACAGGGCCTCAGATG -3'
(R):5'- AGATTGATCAGTAAGTGTGTTGCC -3'

Sequencing Primer
(F):5'- CCACAACTCTCATTGATAGTGGAGG -3'
(R):5'- TTGCCTGTGTACAAAATATGAAGAGG -3'

Posted On

2018-05-04