Incidental Mutation 'R6383:Bst2'
ID 515444
Institutional Source Beutler Lab
Gene Symbol Bst2
Ensembl Gene ENSMUSG00000046718
Gene Name bone marrow stromal cell antigen 2
Synonyms C87040, GREG, Bst-2, 2310015I10Rik
MMRRC Submission 044532-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.060) question?
Stock # R6383 (G1)
Quality Score 225.009
Status Not validated
Chromosome 8
Chromosomal Location 71986899-71990100 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 71989932 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Asparagine at position 47 (I47N)
Ref Sequence ENSEMBL: ENSMUSP00000051921 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000051672]
AlphaFold Q8R2Q8
PDB Structure Crystal Structure of Mouse BST-2/Tetherin Ectodomain [X-RAY DIFFRACTION]
Predicted Effect possibly damaging
Transcript: ENSMUST00000051672
AA Change: I47N

PolyPhen 2 Score 0.953 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000051921
Gene: ENSMUSG00000046718
AA Change: I47N

DomainStartEndE-ValueType
transmembrane domain 29 51 N/A INTRINSIC
Pfam:BST2 54 144 1.9e-37 PFAM
low complexity region 148 171 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000212386
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 97.9%
Validation Efficiency 97% (73/75)
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele exhibit increased susceptibility to the LP-BM5 strain of Mo-MLV (murine AIDS). [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 76 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca12 A T 1: 71,286,343 (GRCm39) M2497K probably benign Het
Abtb2 C T 2: 103,397,721 (GRCm39) T217I probably damaging Het
Adam29 T A 8: 56,324,543 (GRCm39) N637I probably damaging Het
Adgb T A 10: 10,325,772 (GRCm39) E59V probably damaging Het
Adh7 C T 3: 137,933,778 (GRCm39) R312C probably benign Het
Adprh A G 16: 38,267,814 (GRCm39) I157T probably damaging Het
Ap2b1 T C 11: 83,237,651 (GRCm39) S572P probably damaging Het
Asic1 T C 15: 99,596,761 (GRCm39) L519P probably damaging Het
Atp2a2 G C 5: 122,639,712 (GRCm39) L13V probably benign Het
Cacng6 G A 7: 3,473,509 (GRCm39) probably null Het
Cenpe A G 3: 134,957,289 (GRCm39) E1849G probably damaging Het
Cep295 T A 9: 15,244,050 (GRCm39) T213S probably damaging Het
Chia1 A G 3: 106,039,127 (GRCm39) T406A probably benign Het
Chmp4c G T 3: 10,432,277 (GRCm39) K62N probably damaging Het
Cldn15 A G 5: 136,996,979 (GRCm39) T7A probably benign Het
Cmpk2 T A 12: 26,528,019 (GRCm39) M412K probably benign Het
Cnnm1 T C 19: 43,453,705 (GRCm39) probably null Het
Cubn A C 2: 13,432,646 (GRCm39) probably null Het
Dop1b T C 16: 93,579,136 (GRCm39) V1668A possibly damaging Het
Erg28 T A 12: 85,863,203 (GRCm39) Y77F probably damaging Het
F830045P16Rik C T 2: 129,378,358 (GRCm39) A9T probably benign Het
Gli3 A G 13: 15,898,140 (GRCm39) D740G probably damaging Het
Gpat2 G C 2: 127,273,838 (GRCm39) G294R possibly damaging Het
Gpat3 A T 5: 101,041,010 (GRCm39) M357L probably benign Het
Gpr179 A G 11: 97,227,973 (GRCm39) V1394A possibly damaging Het
Grn T A 11: 102,327,621 (GRCm39) probably benign Het
H2-Q6 G A 17: 35,647,359 (GRCm39) probably null Het
Igsf3 A G 3: 101,342,964 (GRCm39) T514A probably benign Het
Il1r1 A G 1: 40,352,495 (GRCm39) D558G possibly damaging Het
Irx4 T C 13: 73,415,832 (GRCm39) M207T possibly damaging Het
Kap T C 6: 133,828,920 (GRCm39) I54V probably benign Het
Kdm2b G A 5: 123,072,841 (GRCm39) R340C probably damaging Het
Lipo3 T A 19: 33,533,831 (GRCm39) M334L probably benign Het
Lmbrd1 C T 1: 24,745,115 (GRCm39) L152F probably damaging Het
Ltbp1 G A 17: 75,666,452 (GRCm39) V1382I probably damaging Het
Map3k4 C T 17: 12,468,470 (GRCm39) D1008N possibly damaging Het
Mcf2l T C 8: 12,929,912 (GRCm39) probably benign Het
Mecom T G 3: 30,051,875 (GRCm39) D180A probably damaging Het
Meis1 T C 11: 18,891,741 (GRCm39) D269G probably benign Het
Myh7 A C 14: 55,226,351 (GRCm39) S430A probably benign Het
Myo1h A G 5: 114,474,325 (GRCm39) I439V probably damaging Het
Nat1 T C 8: 67,944,134 (GRCm39) V170A possibly damaging Het
Nlrp12 A G 7: 3,282,673 (GRCm39) L742P probably damaging Het
Nlrp4c A G 7: 6,069,052 (GRCm39) T318A probably benign Het
Or4d10 T A 19: 12,051,727 (GRCm39) I90F probably damaging Het
Or4k47 T A 2: 111,451,531 (GRCm39) N296I probably benign Het
Or51ai2 A G 7: 103,587,030 (GRCm39) I148V probably benign Het
Or8g33 G T 9: 39,337,530 (GRCm39) T279N probably damaging Het
Or8g35 A T 9: 39,381,926 (GRCm39) L32Q probably damaging Het
Otop3 A G 11: 115,235,898 (GRCm39) E529G probably damaging Het
Parp6 T C 9: 59,531,222 (GRCm39) Y35H probably damaging Het
Pcdhb4 A C 18: 37,441,074 (GRCm39) D128A probably damaging Het
Phldb2 C T 16: 45,569,113 (GRCm39) D1249N probably damaging Het
Pramel30 A T 4: 144,059,717 (GRCm39) *476L probably null Het
Ptpn12 T A 5: 21,192,466 (GRCm39) K765* probably null Het
Ptprb T A 10: 116,182,912 (GRCm39) Y1529* probably null Het
Ptprc A T 1: 138,006,189 (GRCm39) Y798N possibly damaging Het
Sdk2 G A 11: 113,723,091 (GRCm39) T1300I probably damaging Het
Slc28a2b T C 2: 122,355,288 (GRCm39) I555T probably benign Het
Sptbn2 G A 19: 4,782,524 (GRCm39) V487I possibly damaging Het
Sptbn5 A G 2: 119,876,750 (GRCm39) probably benign Het
Srpk1 A G 17: 28,809,036 (GRCm39) S648P probably damaging Het
Stard9 T C 2: 120,496,888 (GRCm39) probably null Het
Tmem135 A T 7: 88,793,878 (GRCm39) I388N probably damaging Het
Top3a A T 11: 60,640,285 (GRCm39) I446N probably benign Het
Trpv1 T C 11: 73,136,862 (GRCm39) S482P probably damaging Het
Ugt3a1 C T 15: 9,306,541 (GRCm39) A230V probably benign Het
Vmn2r15 A C 5: 109,441,092 (GRCm39) Y255* probably null Het
Vmn2r60 A G 7: 41,765,895 (GRCm39) M1V probably null Het
Vmn2r87 A G 10: 130,314,869 (GRCm39) V239A probably damaging Het
Vwce T A 19: 10,636,956 (GRCm39) C679* probably null Het
Zfp385b C T 2: 77,246,185 (GRCm39) A281T probably benign Het
Zfp398 T G 6: 47,843,529 (GRCm39) L395W probably damaging Het
Zfp442 C T 2: 150,293,321 (GRCm39) probably null Het
Zfp606 A G 7: 12,226,871 (GRCm39) S331G probably benign Het
Zfp882 A G 8: 72,668,484 (GRCm39) H437R probably damaging Het
Other mutations in Bst2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01407:Bst2 APN 8 71,989,830 (GRCm39) missense probably damaging 0.97
R0158:Bst2 UTSW 8 71,989,861 (GRCm39) missense possibly damaging 0.95
R6868:Bst2 UTSW 8 71,987,404 (GRCm39) missense unknown
R7109:Bst2 UTSW 8 71,989,926 (GRCm39) missense possibly damaging 0.93
R7322:Bst2 UTSW 8 71,989,851 (GRCm39) missense probably damaging 0.99
R8109:Bst2 UTSW 8 71,989,990 (GRCm39) missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- TGTTTCAAAGCCACTGGAGGG -3'
(R):5'- TTATGCTAATAAGGGCGTGGC -3'

Sequencing Primer
(F):5'- GGACGGATTCCAGGCTTAC -3'
(R):5'- CGTGGCCTGGAAAGGGTTC -3'
Posted On 2018-05-04