Mutagenetix > Incidental Mutation

Incidental Mutation 'R6383:Gli3'

515463

Institutional Source

Beutler Lab

Gene Symbol

Gli3

Ensembl Gene

ENSMUSG00000021318

Gene Name

GLI-Kruppel family member GLI3

Synonyms

brachyphalangy, Bph

MMRRC Submission

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R6383 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

15463235-15730026 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 15723555 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Glycine at position 740 (D740G)

Ref Sequence

ENSEMBL: ENSMUSP00000106137 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000110510]

AlphaFold

Q61602

Predicted Effect

probably damaging
Transcript: ENSMUST00000110510
AA Change: D740G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000106137
Gene: ENSMUSG00000021318
AA Change: D740G

Domain	Start	End	E-Value	Type
low complexity region	120	136	N/A	INTRINSIC
low complexity region	204	220	N/A	INTRINSIC
low complexity region	324	341	N/A	INTRINSIC
low complexity region	403	421	N/A	INTRINSIC
ZnF_C2H2	480	505	1.53e-1	SMART
ZnF_C2H2	513	540	1.23e0	SMART
ZnF_C2H2	546	570	3.16e-3	SMART
ZnF_C2H2	576	601	4.17e-3	SMART
ZnF_C2H2	607	632	1.4e-4	SMART
low complexity region	703	726	N/A	INTRINSIC
low complexity region	756	763	N/A	INTRINSIC
low complexity region	849	880	N/A	INTRINSIC
low complexity region	934	944	N/A	INTRINSIC
low complexity region	1024	1038	N/A	INTRINSIC
low complexity region	1081	1095	N/A	INTRINSIC
low complexity region	1166	1175	N/A	INTRINSIC

Meta Mutation Damage Score

0.8302

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.4%
20x: 97.9%

Validation Efficiency

97% (73/75)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein which belongs to the C2H2-type zinc finger proteins subclass of the Gli family. They are characterized as DNA-binding transcription factors and are mediators of Sonic hedgehog (Shh) signaling. The protein encoded by this gene localizes in the cytoplasm and activates patched Drosophila homolog (PTCH) gene expression. It is also thought to play a role during embryogenesis. Mutations in this gene have been associated with several diseases, including Greig cephalopolysyndactyly syndrome, Pallister-Hall syndrome, preaxial polydactyly type IV, and postaxial polydactyly types A1 and B. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous mutants die perinatally with gross polydactyly, multiple craniofacial defects, and frequently, exencephaly. Heterozygotes exhibit enlarged interfrontal bone and extra preaxial digits. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 76 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abca12	A	T	1: 71,247,184	M2497K	probably benign	Het
Abtb2	C	T	2: 103,567,376	T217I	probably damaging	Het
Adam29	T	A	8: 55,871,508	N637I	probably damaging	Het
Adgb	T	A	10: 10,450,028	E59V	probably damaging	Het
Adh7	C	T	3: 138,228,017	R312C	probably benign	Het
Adprh	A	G	16: 38,447,452	I157T	probably damaging	Het
Ap2b1	T	C	11: 83,346,825	S572P	probably damaging	Het
Asic1	T	C	15: 99,698,880	L519P	probably damaging	Het
Atp2a2	G	C	5: 122,501,649	L13V	probably benign	Het
Bst2	A	T	8: 71,537,288	I47N	possibly damaging	Het
Cacng6	G	A	7: 3,424,993		probably null	Het
Cenpe	A	G	3: 135,251,528	E1849G	probably damaging	Het
Cep295	T	A	9: 15,332,754	T213S	probably damaging	Het
Chia1	A	G	3: 106,131,811	T406A	probably benign	Het
Chmp4c	G	T	3: 10,367,217	K62N	probably damaging	Het
Cldn15	A	G	5: 136,968,125	T7A	probably benign	Het
Cmpk2	T	A	12: 26,478,020	M412K	probably benign	Het
Cnnm1	T	C	19: 43,465,266		probably null	Het
Cubn	A	C	2: 13,427,835		probably null	Het
Dopey2	T	C	16: 93,782,248	V1668A	possibly damaging	Het
Erg28	T	A	12: 85,816,429	Y77F	probably damaging	Het
F830045P16Rik	C	T	2: 129,536,438	A9T	probably benign	Het
Gm13128	A	T	4: 144,333,147	*476L	probably null	Het
Gm14085	T	C	2: 122,524,807	I555T	probably benign	Het
Gpat2	G	C	2: 127,431,918	G294R	possibly damaging	Het
Gpat3	A	T	5: 100,893,144	M357L	probably benign	Het
Gpr179	A	G	11: 97,337,147	V1394A	possibly damaging	Het
Grn	T	A	11: 102,436,795		probably benign	Het
H2-Q6	G	A	17: 35,428,383		probably null	Het
Igsf3	A	G	3: 101,435,648	T514A	probably benign	Het
Il1r1	A	G	1: 40,313,335	D558G	possibly damaging	Het
Irx4	T	C	13: 73,267,713	M207T	possibly damaging	Het
Kap	T	C	6: 133,851,957	I54V	probably benign	Het
Kdm2b	G	A	5: 122,934,778	R340C	probably damaging	Het
Lipo3	T	A	19: 33,556,431	M334L	probably benign	Het
Lmbrd1	C	T	1: 24,706,034	L152F	probably damaging	Het
Ltbp1	G	A	17: 75,359,457	V1382I	probably damaging	Het
Map3k4	C	T	17: 12,249,583	D1008N	possibly damaging	Het
Mcf2l	T	C	8: 12,879,912		probably benign	Het
Mecom	T	G	3: 29,997,726	D180A	probably damaging	Het
Meis1	T	C	11: 18,941,741	D269G	probably benign	Het
Myh7	A	C	14: 54,988,894	S430A	probably benign	Het
Myo1h	A	G	5: 114,336,264	I439V	probably damaging	Het
Nat1	T	C	8: 67,491,482	V170A	possibly damaging	Het
Nlrp12	A	G	7: 3,234,043	L742P	probably damaging	Het
Nlrp4c	A	G	7: 6,066,053	T318A	probably benign	Het
Olfr1297	T	A	2: 111,621,186	N296I	probably benign	Het
Olfr1425	T	A	19: 12,074,363	I90F	probably damaging	Het
Olfr632	A	G	7: 103,937,823	I148V	probably benign	Het
Olfr952	G	T	9: 39,426,234	T279N	probably damaging	Het
Olfr955	A	T	9: 39,470,630	L32Q	probably damaging	Het
Otop3	A	G	11: 115,345,072	E529G	probably damaging	Het
Parp6	T	C	9: 59,623,939	Y35H	probably damaging	Het
Pcdhb4	A	C	18: 37,308,021	D128A	probably damaging	Het
Phldb2	C	T	16: 45,748,750	D1249N	probably damaging	Het
Ptpn12	T	A	5: 20,987,468	K765*	probably null	Het
Ptprb	T	A	10: 116,347,007	Y1529*	probably null	Het
Ptprc	A	T	1: 138,078,451	Y798N	possibly damaging	Het
Sdk2	G	A	11: 113,832,265	T1300I	probably damaging	Het
Sptbn2	G	A	19: 4,732,496	V487I	possibly damaging	Het
Sptbn5	A	G	2: 120,046,269		probably benign	Het
Srpk1	A	G	17: 28,590,062	S648P	probably damaging	Het
Stard9	T	C	2: 120,666,407		probably null	Het
Tmem135	A	T	7: 89,144,670	I388N	probably damaging	Het
Top3a	A	T	11: 60,749,459	I446N	probably benign	Het
Trpv1	T	C	11: 73,246,036	S482P	probably damaging	Het
Ugt3a1	C	T	15: 9,306,455	A230V	probably benign	Het
Vmn2r15	A	C	5: 109,293,226	Y255*	probably null	Het
Vmn2r60	A	G	7: 42,116,471	M1V	probably null	Het
Vmn2r87	A	G	10: 130,479,000	V239A	probably damaging	Het
Vwce	T	A	19: 10,659,592	C679*	probably null	Het
Zfp385b	C	T	2: 77,415,841	A281T	probably benign	Het
Zfp398	T	G	6: 47,866,595	L395W	probably damaging	Het
Zfp442	C	T	2: 150,451,401		probably null	Het
Zfp606	A	G	7: 12,492,944	S331G	probably benign	Het
Zfp882	A	G	8: 71,914,640	H437R	probably damaging	Het

Other mutations in Gli3

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00417:Gli3	APN	13	15644299	missense	probably damaging	1.00
IGL00471:Gli3	APN	13	15723769	critical splice donor site	probably null
IGL00484:Gli3	APN	13	15644392	missense	possibly damaging	0.84
IGL00588:Gli3	APN	13	15644392	missense	possibly damaging	0.84
IGL01161:Gli3	APN	13	15548398	critical splice acceptor site	probably null
IGL01633:Gli3	APN	13	15648634	missense	probably damaging	1.00
IGL01799:Gli3	APN	13	15726161	missense	probably benign	0.00
IGL01861:Gli3	APN	13	15725325	missense	probably damaging	1.00
IGL02063:Gli3	APN	13	15726372	missense	possibly damaging	0.94
IGL02112:Gli3	APN	13	15662514	missense	probably damaging	1.00
IGL02255:Gli3	APN	13	15648719	missense	probably damaging	1.00
IGL02270:Gli3	APN	13	15726786	utr 3 prime	probably benign
IGL02336:Gli3	APN	13	15720289	missense	probably damaging	1.00
IGL02346:Gli3	APN	13	15723693	missense	probably damaging	1.00
IGL02744:Gli3	APN	13	15613886	critical splice donor site	probably null
IGL02877:Gli3	APN	13	15724742	missense	probably damaging	1.00
IGL02975:Gli3	APN	13	15724568	missense	probably damaging	1.00
IGL03018:Gli3	APN	13	15660132	missense	probably damaging	1.00
IGL03378:Gli3	APN	13	15644420	missense	probably damaging	1.00
IGL03406:Gli3	APN	13	15648581	missense	probably damaging	1.00
Capone	UTSW	13	15715034	missense	probably damaging	1.00
Carpals	UTSW	13	15713650	critical splice donor site	probably null
Ness	UTSW	13	15723555	missense	probably damaging	1.00
FR4737:Gli3	UTSW	13	15644357	missense	probably damaging	1.00
R0110:Gli3	UTSW	13	15724785	missense	probably damaging	1.00
R0329:Gli3	UTSW	13	15723558	missense	probably damaging	0.98
R0330:Gli3	UTSW	13	15723558	missense	probably damaging	0.98
R0360:Gli3	UTSW	13	15724764	missense	probably benign	0.32
R0364:Gli3	UTSW	13	15724764	missense	probably benign	0.32
R0469:Gli3	UTSW	13	15724785	missense	probably damaging	1.00
R0616:Gli3	UTSW	13	15662406	missense	possibly damaging	0.75
R0639:Gli3	UTSW	13	15724715	missense	probably damaging	1.00
R1072:Gli3	UTSW	13	15713605	missense	probably damaging	1.00
R1257:Gli3	UTSW	13	15725996	nonsense	probably null
R1270:Gli3	UTSW	13	15723744	missense	probably benign	0.02
R1424:Gli3	UTSW	13	15726314	missense	probably benign	0.00
R1481:Gli3	UTSW	13	15613850	missense	probably damaging	0.99
R1596:Gli3	UTSW	13	15725471	missense	possibly damaging	0.74
R1628:Gli3	UTSW	13	15726312	missense	probably benign	0.00
R1721:Gli3	UTSW	13	15726297	missense	probably benign	0.27
R1797:Gli3	UTSW	13	15713512	missense	probably damaging	0.99
R1813:Gli3	UTSW	13	15648691	missense	probably damaging	1.00
R1819:Gli3	UTSW	13	15725792	nonsense	probably null
R1988:Gli3	UTSW	13	15726380	missense	probably benign
R2132:Gli3	UTSW	13	15725549	missense	possibly damaging	0.74
R2352:Gli3	UTSW	13	15662392	missense	probably benign	0.02
R3085:Gli3	UTSW	13	15660941	missense	probably damaging	1.00
R3177:Gli3	UTSW	13	15725982	missense	probably benign	0.28
R3277:Gli3	UTSW	13	15725982	missense	probably benign	0.28
R4162:Gli3	UTSW	13	15725115	missense	possibly damaging	0.93
R4497:Gli3	UTSW	13	15723571	missense	possibly damaging	0.74
R4526:Gli3	UTSW	13	15713631	missense	probably damaging	1.00
R4979:Gli3	UTSW	13	15724464	missense	possibly damaging	0.87
R5327:Gli3	UTSW	13	15548507	missense	probably damaging	0.99
R5395:Gli3	UTSW	13	15714950	missense	probably damaging	1.00
R5494:Gli3	UTSW	13	15725982	missense	probably benign	0.28
R5609:Gli3	UTSW	13	15548453	missense	possibly damaging	0.82
R5718:Gli3	UTSW	13	15478165	critical splice donor site	probably null
R5810:Gli3	UTSW	13	15644309	missense	probably damaging	0.99
R5896:Gli3	UTSW	13	15726180	missense	probably benign	0.00
R5930:Gli3	UTSW	13	15548625	missense	probably damaging	1.00
R5964:Gli3	UTSW	13	15726162	nonsense	probably null
R5985:Gli3	UTSW	13	15723555	missense	probably damaging	1.00
R6224:Gli3	UTSW	13	15725145	missense	probably benign
R6278:Gli3	UTSW	13	15725113	missense	possibly damaging	0.69
R6330:Gli3	UTSW	13	15724732	missense	probably damaging	1.00
R6523:Gli3	UTSW	13	15713650	critical splice donor site	probably null
R7072:Gli3	UTSW	13	15725695	missense	possibly damaging	0.51
R7085:Gli3	UTSW	13	15715062	missense	probably damaging	1.00
R7228:Gli3	UTSW	13	15724502	missense	probably benign	0.00
R7327:Gli3	UTSW	13	15725559	missense	probably benign	0.02
R7451:Gli3	UTSW	13	15726291	missense	possibly damaging	0.50
R7974:Gli3	UTSW	13	15726256	missense	probably benign	0.00
R8167:Gli3	UTSW	13	15725643	missense	probably benign	0.00
R8170:Gli3	UTSW	13	15720208	missense	probably benign
R8199:Gli3	UTSW	13	15725991	missense	probably benign	0.08
R8247:Gli3	UTSW	13	15726775	missense	possibly damaging	0.82
R8332:Gli3	UTSW	13	15713548	missense	possibly damaging	0.58
R8347:Gli3	UTSW	13	15723525	missense	probably damaging	1.00
R8559:Gli3	UTSW	13	15660132	missense	probably damaging	1.00
R8676:Gli3	UTSW	13	15715034	missense	probably damaging	1.00
R8905:Gli3	UTSW	13	15726531	missense	probably benign	0.01
R9099:Gli3	UTSW	13	15726735	missense	probably damaging	1.00
R9260:Gli3	UTSW	13	15725090	missense	probably damaging	0.99
R9317:Gli3	UTSW	13	15715073	missense	probably damaging	1.00
R9475:Gli3	UTSW	13	15725711	missense	possibly damaging	0.87
R9546:Gli3	UTSW	13	15613858	missense	probably benign	0.00
R9571:Gli3	UTSW	13	15726273	missense	probably benign	0.00
R9621:Gli3	UTSW	13	15726668	missense	probably benign	0.01
R9704:Gli3	UTSW	13	15723473	missense	probably damaging	1.00
R9787:Gli3	UTSW	13	15725801	missense	probably damaging	0.96
RF010:Gli3	UTSW	13	15726369	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- CATGAACTGTCATTTTGGCTCC -3'
(R):5'- TAGGGTGGGACGTACCATTTC -3'

Sequencing Primer
(F):5'- GAACTGTCATTTTGGCTCCCTCTC -3'
(R):5'- GGACGTACCATTTCCTATGAGAG -3'

Posted On

2018-05-04