Incidental Mutation 'R6383:Irx4'
ID515464
Institutional Source Beutler Lab
Gene Symbol Irx4
Ensembl Gene ENSMUSG00000021604
Gene NameIroquois homeobox 4
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.780) question?
Stock #R6383 (G1)
Quality Score225.009
Status Validated
Chromosome13
Chromosomal Location73260479-73269608 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 73267713 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Threonine at position 207 (M207T)
Ref Sequence ENSEMBL: ENSMUSP00000134738 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022095] [ENSMUST00000176684]
Predicted Effect possibly damaging
Transcript: ENSMUST00000022095
AA Change: M207T

PolyPhen 2 Score 0.917 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000022095
Gene: ENSMUSG00000021604
AA Change: M207T

DomainStartEndE-ValueType
low complexity region 71 84 N/A INTRINSIC
low complexity region 116 129 N/A INTRINSIC
HOX 143 208 5.33e-13 SMART
low complexity region 223 238 N/A INTRINSIC
low complexity region 252 268 N/A INTRINSIC
IRO 362 379 6.36e-4 SMART
low complexity region 399 419 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000176684
AA Change: M207T

PolyPhen 2 Score 0.917 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000134738
Gene: ENSMUSG00000021604
AA Change: M207T

DomainStartEndE-ValueType
low complexity region 71 84 N/A INTRINSIC
low complexity region 116 129 N/A INTRINSIC
HOX 143 208 5.33e-13 SMART
low complexity region 223 238 N/A INTRINSIC
low complexity region 252 268 N/A INTRINSIC
IRO 362 379 6.36e-4 SMART
low complexity region 399 419 N/A INTRINSIC
Meta Mutation Damage Score 0.2925 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 97.9%
Validation Efficiency 97% (73/75)
MGI Phenotype PHENOTYPE: Homozygotes for a targeted null mutation exhibit abnormal ventricular gene expression followed by cardiomyopathy with hypertrophy and impaired contractile function. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 76 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca12 A T 1: 71,247,184 M2497K probably benign Het
Abtb2 C T 2: 103,567,376 T217I probably damaging Het
Adam29 T A 8: 55,871,508 N637I probably damaging Het
Adgb T A 10: 10,450,028 E59V probably damaging Het
Adh7 C T 3: 138,228,017 R312C probably benign Het
Adprh A G 16: 38,447,452 I157T probably damaging Het
Ap2b1 T C 11: 83,346,825 S572P probably damaging Het
Asic1 T C 15: 99,698,880 L519P probably damaging Het
Atp2a2 G C 5: 122,501,649 L13V probably benign Het
Bst2 A T 8: 71,537,288 I47N possibly damaging Het
Cacng6 G A 7: 3,424,993 probably null Het
Cenpe A G 3: 135,251,528 E1849G probably damaging Het
Cep295 T A 9: 15,332,754 T213S probably damaging Het
Chia1 A G 3: 106,131,811 T406A probably benign Het
Chmp4c G T 3: 10,367,217 K62N probably damaging Het
Cldn15 A G 5: 136,968,125 T7A probably benign Het
Cmpk2 T A 12: 26,478,020 M412K probably benign Het
Cnnm1 T C 19: 43,465,266 probably null Het
Cubn A C 2: 13,427,835 probably null Het
Dopey2 T C 16: 93,782,248 V1668A possibly damaging Het
Erg28 T A 12: 85,816,429 Y77F probably damaging Het
F830045P16Rik C T 2: 129,536,438 A9T probably benign Het
Gli3 A G 13: 15,723,555 D740G probably damaging Het
Gm13128 A T 4: 144,333,147 *476L probably null Het
Gm14085 T C 2: 122,524,807 I555T probably benign Het
Gpat2 G C 2: 127,431,918 G294R possibly damaging Het
Gpat3 A T 5: 100,893,144 M357L probably benign Het
Gpr179 A G 11: 97,337,147 V1394A possibly damaging Het
Grn T A 11: 102,436,795 probably benign Het
H2-Q6 G A 17: 35,428,383 probably null Het
Igsf3 A G 3: 101,435,648 T514A probably benign Het
Il1r1 A G 1: 40,313,335 D558G possibly damaging Het
Kap T C 6: 133,851,957 I54V probably benign Het
Kdm2b G A 5: 122,934,778 R340C probably damaging Het
Lipo3 T A 19: 33,556,431 M334L probably benign Het
Lmbrd1 C T 1: 24,706,034 L152F probably damaging Het
Ltbp1 G A 17: 75,359,457 V1382I probably damaging Het
Map3k4 C T 17: 12,249,583 D1008N possibly damaging Het
Mcf2l T C 8: 12,879,912 probably benign Het
Mecom T G 3: 29,997,726 D180A probably damaging Het
Meis1 T C 11: 18,941,741 D269G probably benign Het
Myh7 A C 14: 54,988,894 S430A probably benign Het
Myo1h A G 5: 114,336,264 I439V probably damaging Het
Nat1 T C 8: 67,491,482 V170A possibly damaging Het
Nlrp12 A G 7: 3,234,043 L742P probably damaging Het
Nlrp4c A G 7: 6,066,053 T318A probably benign Het
Olfr1297 T A 2: 111,621,186 N296I probably benign Het
Olfr1425 T A 19: 12,074,363 I90F probably damaging Het
Olfr632 A G 7: 103,937,823 I148V probably benign Het
Olfr952 G T 9: 39,426,234 T279N probably damaging Het
Olfr955 A T 9: 39,470,630 L32Q probably damaging Het
Otop3 A G 11: 115,345,072 E529G probably damaging Het
Parp6 T C 9: 59,623,939 Y35H probably damaging Het
Pcdhb4 A C 18: 37,308,021 D128A probably damaging Het
Phldb2 C T 16: 45,748,750 D1249N probably damaging Het
Ptpn12 T A 5: 20,987,468 K765* probably null Het
Ptprb T A 10: 116,347,007 Y1529* probably null Het
Ptprc A T 1: 138,078,451 Y798N possibly damaging Het
Sdk2 G A 11: 113,832,265 T1300I probably damaging Het
Sptbn2 G A 19: 4,732,496 V487I possibly damaging Het
Sptbn5 A G 2: 120,046,269 probably benign Het
Srpk1 A G 17: 28,590,062 S648P probably damaging Het
Stard9 T C 2: 120,666,407 probably null Het
Tmem135 A T 7: 89,144,670 I388N probably damaging Het
Top3a A T 11: 60,749,459 I446N probably benign Het
Trpv1 T C 11: 73,246,036 S482P probably damaging Het
Ugt3a1 C T 15: 9,306,455 A230V probably benign Het
Vmn2r15 A C 5: 109,293,226 Y255* probably null Het
Vmn2r60 A G 7: 42,116,471 M1V probably null Het
Vmn2r87 A G 10: 130,479,000 V239A probably damaging Het
Vwce T A 19: 10,659,592 C679* probably null Het
Zfp385b C T 2: 77,415,841 A281T probably benign Het
Zfp398 T G 6: 47,866,595 L395W probably damaging Het
Zfp442 C T 2: 150,451,401 probably null Het
Zfp606 A G 7: 12,492,944 S331G probably benign Het
Zfp882 A G 8: 71,914,640 H437R probably damaging Het
Other mutations in Irx4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00335:Irx4 APN 13 73268691 missense probably benign
IGL00979:Irx4 APN 13 73268222 splice site probably benign
IGL01291:Irx4 APN 13 73267667 missense probably damaging 1.00
IGL02054:Irx4 APN 13 73268828 missense probably damaging 1.00
IGL02631:Irx4 APN 13 73268477 missense probably damaging 1.00
IGL02893:Irx4 APN 13 73268778 missense probably damaging 1.00
IGL03310:Irx4 APN 13 73267731 missense possibly damaging 0.47
ANU05:Irx4 UTSW 13 73267667 missense probably damaging 1.00
R0468:Irx4 UTSW 13 73266720 splice site probably benign
R0502:Irx4 UTSW 13 73266584 splice site probably null
R0503:Irx4 UTSW 13 73266584 splice site probably null
R1468:Irx4 UTSW 13 73265576 missense possibly damaging 0.53
R1468:Irx4 UTSW 13 73265576 missense possibly damaging 0.53
R1710:Irx4 UTSW 13 73267638 missense possibly damaging 0.90
R1733:Irx4 UTSW 13 73266705 missense probably benign 0.00
R2076:Irx4 UTSW 13 73268265 missense probably damaging 1.00
R2092:Irx4 UTSW 13 73265486 missense probably damaging 0.97
R2127:Irx4 UTSW 13 73265476 missense probably benign 0.03
R2199:Irx4 UTSW 13 73265601 missense probably benign 0.16
R4157:Irx4 UTSW 13 73265543 missense probably benign 0.00
R4883:Irx4 UTSW 13 73267631 missense probably damaging 1.00
R4930:Irx4 UTSW 13 73268913 missense probably benign 0.00
R4990:Irx4 UTSW 13 73265507 missense probably benign 0.28
R4991:Irx4 UTSW 13 73265507 missense probably benign 0.28
R5119:Irx4 UTSW 13 73268921 missense probably benign
R5399:Irx4 UTSW 13 73265539 missense probably benign 0.01
R5596:Irx4 UTSW 13 73267680 missense probably damaging 1.00
R5956:Irx4 UTSW 13 73267507 nonsense probably null
R6271:Irx4 UTSW 13 73266594 critical splice acceptor site probably null
R6630:Irx4 UTSW 13 73268426 missense probably benign 0.00
R6631:Irx4 UTSW 13 73268426 missense probably benign 0.00
R6632:Irx4 UTSW 13 73268426 missense probably benign 0.00
R6633:Irx4 UTSW 13 73268426 missense probably benign 0.00
R7378:Irx4 UTSW 13 73267553 missense possibly damaging 0.52
Predicted Primers PCR Primer
(F):5'- ATTGCAGAGCCTGTCTCCAG -3'
(R):5'- TTCCATTTGCCACCCAACGG -3'

Sequencing Primer
(F):5'- CACGCGGCGCAAGAATG -3'
(R):5'- CCCAACGGCTTCCAGAG -3'
Posted On2018-05-04