Incidental Mutation 'R6383:Asic1'
ID515467
Institutional Source Beutler Lab
Gene Symbol Asic1
Ensembl Gene ENSMUSG00000023017
Gene Nameacid-sensing (proton-gated) ion channel 1
SynonymsASIC1a, ASICalpha, B530003N02Rik, ASIC, Accn2, BNaC2, ASIC1 beta
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.232) question?
Stock #R6383 (G1)
Quality Score225.009
Status Validated
Chromosome15
Chromosomal Location99670368-99701130 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 99698880 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Proline at position 519 (L519P)
Ref Sequence ENSEMBL: ENSMUSP00000154379 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023758] [ENSMUST00000023759] [ENSMUST00000163472] [ENSMUST00000228185] [ENSMUST00000228984] [ENSMUST00000229236] [ENSMUST00000229845] [ENSMUST00000230530]
Predicted Effect probably benign
Transcript: ENSMUST00000023758
AA Change: L486P

PolyPhen 2 Score 0.039 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000023758
Gene: ENSMUSG00000023017
AA Change: L486P

DomainStartEndE-ValueType
Pfam:ASC 21 454 9.9e-95 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000023759
SMART Domains Protein: ENSMUSP00000023759
Gene: ENSMUSG00000023018

DomainStartEndE-ValueType
low complexity region 9 38 N/A INTRINSIC
low complexity region 103 117 N/A INTRINSIC
Blast:KISc 124 271 2e-43 BLAST
SWIB 291 370 1.97e-35 SMART
Blast:MYSc 452 498 2e-17 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000163472
SMART Domains Protein: ENSMUSP00000128823
Gene: ENSMUSG00000091604

DomainStartEndE-ValueType
low complexity region 18 42 N/A INTRINSIC
low complexity region 44 78 N/A INTRINSIC
low complexity region 85 93 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000226291
Predicted Effect noncoding transcript
Transcript: ENSMUST00000227670
Predicted Effect noncoding transcript
Transcript: ENSMUST00000228012
Predicted Effect probably damaging
Transcript: ENSMUST00000228185
AA Change: L519P

PolyPhen 2 Score 0.959 (Sensitivity: 0.78; Specificity: 0.95)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000228610
Predicted Effect probably benign
Transcript: ENSMUST00000228984
Predicted Effect probably benign
Transcript: ENSMUST00000229236
Predicted Effect noncoding transcript
Transcript: ENSMUST00000229686
Predicted Effect probably benign
Transcript: ENSMUST00000229845
Predicted Effect noncoding transcript
Transcript: ENSMUST00000229968
Predicted Effect probably benign
Transcript: ENSMUST00000230530
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 97.9%
Validation Efficiency 97% (73/75)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the acid-sensing ion channel (ASIC) family of proteins, which are part of the degenerin/epithelial sodium channel (DEG/ENaC) superfamily. Members of the ASIC family are sensitive to amiloride and function in neurotransmission. The encoded proteins function in learning, pain transduction, touch sensation, and development of memory and fear. Alternatively spliced transcript variants have been described. [provided by RefSeq, Feb 2012]
PHENOTYPE: Homozygous mutation of this gene results in absence of H+-gated currents in hippocampal neurons, impaired long term potentiation, reduced excitatory postsynaptic potentials, and defective spatial learning and eye blink conditioning. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 76 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca12 A T 1: 71,247,184 M2497K probably benign Het
Abtb2 C T 2: 103,567,376 T217I probably damaging Het
Adam29 T A 8: 55,871,508 N637I probably damaging Het
Adgb T A 10: 10,450,028 E59V probably damaging Het
Adh7 C T 3: 138,228,017 R312C probably benign Het
Adprh A G 16: 38,447,452 I157T probably damaging Het
Ap2b1 T C 11: 83,346,825 S572P probably damaging Het
Atp2a2 G C 5: 122,501,649 L13V probably benign Het
Bst2 A T 8: 71,537,288 I47N possibly damaging Het
Cacng6 G A 7: 3,424,993 probably null Het
Cenpe A G 3: 135,251,528 E1849G probably damaging Het
Cep295 T A 9: 15,332,754 T213S probably damaging Het
Chia1 A G 3: 106,131,811 T406A probably benign Het
Chmp4c G T 3: 10,367,217 K62N probably damaging Het
Cldn15 A G 5: 136,968,125 T7A probably benign Het
Cmpk2 T A 12: 26,478,020 M412K probably benign Het
Cnnm1 T C 19: 43,465,266 probably null Het
Cubn A C 2: 13,427,835 probably null Het
Dopey2 T C 16: 93,782,248 V1668A possibly damaging Het
Erg28 T A 12: 85,816,429 Y77F probably damaging Het
F830045P16Rik C T 2: 129,536,438 A9T probably benign Het
Gli3 A G 13: 15,723,555 D740G probably damaging Het
Gm13128 A T 4: 144,333,147 *476L probably null Het
Gm14085 T C 2: 122,524,807 I555T probably benign Het
Gpat2 G C 2: 127,431,918 G294R possibly damaging Het
Gpat3 A T 5: 100,893,144 M357L probably benign Het
Gpr179 A G 11: 97,337,147 V1394A possibly damaging Het
Grn T A 11: 102,436,795 probably benign Het
H2-Q6 G A 17: 35,428,383 probably null Het
Igsf3 A G 3: 101,435,648 T514A probably benign Het
Il1r1 A G 1: 40,313,335 D558G possibly damaging Het
Irx4 T C 13: 73,267,713 M207T possibly damaging Het
Kap T C 6: 133,851,957 I54V probably benign Het
Kdm2b G A 5: 122,934,778 R340C probably damaging Het
Lipo3 T A 19: 33,556,431 M334L probably benign Het
Lmbrd1 C T 1: 24,706,034 L152F probably damaging Het
Ltbp1 G A 17: 75,359,457 V1382I probably damaging Het
Map3k4 C T 17: 12,249,583 D1008N possibly damaging Het
Mcf2l T C 8: 12,879,912 probably benign Het
Mecom T G 3: 29,997,726 D180A probably damaging Het
Meis1 T C 11: 18,941,741 D269G probably benign Het
Myh7 A C 14: 54,988,894 S430A probably benign Het
Myo1h A G 5: 114,336,264 I439V probably damaging Het
Nat1 T C 8: 67,491,482 V170A possibly damaging Het
Nlrp12 A G 7: 3,234,043 L742P probably damaging Het
Nlrp4c A G 7: 6,066,053 T318A probably benign Het
Olfr1297 T A 2: 111,621,186 N296I probably benign Het
Olfr1425 T A 19: 12,074,363 I90F probably damaging Het
Olfr632 A G 7: 103,937,823 I148V probably benign Het
Olfr952 G T 9: 39,426,234 T279N probably damaging Het
Olfr955 A T 9: 39,470,630 L32Q probably damaging Het
Otop3 A G 11: 115,345,072 E529G probably damaging Het
Parp6 T C 9: 59,623,939 Y35H probably damaging Het
Pcdhb4 A C 18: 37,308,021 D128A probably damaging Het
Phldb2 C T 16: 45,748,750 D1249N probably damaging Het
Ptpn12 T A 5: 20,987,468 K765* probably null Het
Ptprb T A 10: 116,347,007 Y1529* probably null Het
Ptprc A T 1: 138,078,451 Y798N possibly damaging Het
Sdk2 G A 11: 113,832,265 T1300I probably damaging Het
Sptbn2 G A 19: 4,732,496 V487I possibly damaging Het
Sptbn5 A G 2: 120,046,269 probably benign Het
Srpk1 A G 17: 28,590,062 S648P probably damaging Het
Stard9 T C 2: 120,666,407 probably null Het
Tmem135 A T 7: 89,144,670 I388N probably damaging Het
Top3a A T 11: 60,749,459 I446N probably benign Het
Trpv1 T C 11: 73,246,036 S482P probably damaging Het
Ugt3a1 C T 15: 9,306,455 A230V probably benign Het
Vmn2r15 A C 5: 109,293,226 Y255* probably null Het
Vmn2r60 A G 7: 42,116,471 M1V probably null Het
Vmn2r87 A G 10: 130,479,000 V239A probably damaging Het
Vwce T A 19: 10,659,592 C679* probably null Het
Zfp385b C T 2: 77,415,841 A281T probably benign Het
Zfp398 T G 6: 47,866,595 L395W probably damaging Het
Zfp442 C T 2: 150,451,401 probably null Het
Zfp606 A G 7: 12,492,944 S331G probably benign Het
Zfp882 A G 8: 71,914,640 H437R probably damaging Het
Other mutations in Asic1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01413:Asic1 APN 15 99672117 missense probably damaging 0.99
IGL01418:Asic1 APN 15 99672117 missense probably damaging 0.99
IGL01718:Asic1 APN 15 99672002 missense probably damaging 1.00
IGL01941:Asic1 APN 15 99699101 missense possibly damaging 0.95
IGL01993:Asic1 APN 15 99697472 missense probably benign 0.01
IGL02097:Asic1 APN 15 99694686 splice site probably benign
IGL03028:Asic1 APN 15 99672157 missense probably benign 0.03
IGL03082:Asic1 APN 15 99696547 missense probably benign
IGL03183:Asic1 APN 15 99672017 missense probably benign 0.43
IGL03231:Asic1 APN 15 99699102 missense probably benign 0.42
R0111:Asic1 UTSW 15 99696983 missense probably damaging 1.00
R0243:Asic1 UTSW 15 99698617 unclassified probably benign
R0316:Asic1 UTSW 15 99671938 missense probably benign 0.03
R0518:Asic1 UTSW 15 99698819 missense probably damaging 1.00
R0520:Asic1 UTSW 15 99695535 missense probably damaging 1.00
R0521:Asic1 UTSW 15 99698819 missense probably damaging 1.00
R0610:Asic1 UTSW 15 99698899 missense probably benign 0.14
R1034:Asic1 UTSW 15 99698058 missense probably damaging 1.00
R1666:Asic1 UTSW 15 99699125 missense probably damaging 1.00
R1796:Asic1 UTSW 15 99696654 missense probably null 0.99
R1993:Asic1 UTSW 15 99671884 missense probably damaging 1.00
R2130:Asic1 UTSW 15 99671875 missense possibly damaging 0.73
R2180:Asic1 UTSW 15 99671965 missense probably benign
R2895:Asic1 UTSW 15 99696602 missense probably benign 0.22
R3793:Asic1 UTSW 15 99672025 nonsense probably null
R3848:Asic1 UTSW 15 99672933 missense probably benign 0.01
R5115:Asic1 UTSW 15 99672052 missense probably damaging 0.97
R5186:Asic1 UTSW 15 99698803 unclassified probably benign
R5187:Asic1 UTSW 15 99698803 unclassified probably benign
R5409:Asic1 UTSW 15 99698803 unclassified probably benign
R6011:Asic1 UTSW 15 99699079 missense probably benign 0.05
R7133:Asic1 UTSW 15 99672087 missense probably damaging 1.00
R7255:Asic1 UTSW 15 99697457 missense probably damaging 0.97
R7587:Asic1 UTSW 15 99695590 missense probably damaging 1.00
R8012:Asic1 UTSW 15 99696651 missense possibly damaging 0.92
R8030:Asic1 UTSW 15 99694841 missense possibly damaging 0.56
R8089:Asic1 UTSW 15 99698087 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGACTATGCCTATGAGGTAAGGAGG -3'
(R):5'- TAGGATGTTGGCAGCGTACG -3'

Sequencing Primer
(F):5'- TATGCCTATGAGGTAAGGAGGTAAGG -3'
(R):5'- TTGGCAGCGTACGTCATC -3'
Posted On2018-05-04