Incidental Mutation 'R6383:Srpk1'
ID515472
Institutional Source Beutler Lab
Gene Symbol Srpk1
Ensembl Gene ENSMUSG00000004865
Gene Nameserine/arginine-rich protein specific kinase 1
SynonymsSR protein-specific kinase 1
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.794) question?
Stock #R6383 (G1)
Quality Score225.009
Status Validated
Chromosome17
Chromosomal Location28587648-28622521 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 28590062 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 648 (S648P)
Ref Sequence ENSEMBL: ENSMUSP00000116259 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000004987] [ENSMUST00000130643]
Predicted Effect probably benign
Transcript: ENSMUST00000004987
SMART Domains Protein: ENSMUSP00000004987
Gene: ENSMUSG00000004865

DomainStartEndE-ValueType
Pfam:Pkinase_Tyr 8 158 1.8e-12 PFAM
Pfam:Pkinase 8 160 1.5e-25 PFAM
low complexity region 169 183 N/A INTRINSIC
low complexity region 195 210 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000130643
AA Change: S648P

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000116259
Gene: ENSMUSG00000004865
AA Change: S648P

DomainStartEndE-ValueType
low complexity region 10 25 N/A INTRINSIC
Pfam:Pkinase_Tyr 80 229 6.8e-11 PFAM
Pfam:Pkinase 80 231 5.6e-23 PFAM
low complexity region 241 255 N/A INTRINSIC
coiled coil region 264 297 N/A INTRINSIC
Pfam:Pkinase 468 646 3e-19 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000136504
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 97.9%
Validation Efficiency 97% (73/75)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a serine/arginine protein kinase specific for the SR (serine/arginine-rich domain) family of splicing factors. The protein localizes to the nucleus and the cytoplasm. It is thought to play a role in regulation of both constitutive and alternative splicing by regulating intracellular localization of splicing factors. Alternative splicing of this gene results in multiple transcript variants. Additional alternatively spliced transcript variants have been described for this gene, but their full length nature have not been determined.[provided by RefSeq, Jul 2010]
Allele List at MGI
Other mutations in this stock
Total: 76 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca12 A T 1: 71,247,184 M2497K probably benign Het
Abtb2 C T 2: 103,567,376 T217I probably damaging Het
Adam29 T A 8: 55,871,508 N637I probably damaging Het
Adgb T A 10: 10,450,028 E59V probably damaging Het
Adh7 C T 3: 138,228,017 R312C probably benign Het
Adprh A G 16: 38,447,452 I157T probably damaging Het
Ap2b1 T C 11: 83,346,825 S572P probably damaging Het
Asic1 T C 15: 99,698,880 L519P probably damaging Het
Atp2a2 G C 5: 122,501,649 L13V probably benign Het
Bst2 A T 8: 71,537,288 I47N possibly damaging Het
Cacng6 G A 7: 3,424,993 probably null Het
Cenpe A G 3: 135,251,528 E1849G probably damaging Het
Cep295 T A 9: 15,332,754 T213S probably damaging Het
Chia1 A G 3: 106,131,811 T406A probably benign Het
Chmp4c G T 3: 10,367,217 K62N probably damaging Het
Cldn15 A G 5: 136,968,125 T7A probably benign Het
Cmpk2 T A 12: 26,478,020 M412K probably benign Het
Cnnm1 T C 19: 43,465,266 probably null Het
Cubn A C 2: 13,427,835 probably null Het
Dopey2 T C 16: 93,782,248 V1668A possibly damaging Het
Erg28 T A 12: 85,816,429 Y77F probably damaging Het
F830045P16Rik C T 2: 129,536,438 A9T probably benign Het
Gli3 A G 13: 15,723,555 D740G probably damaging Het
Gm13128 A T 4: 144,333,147 *476L probably null Het
Gm14085 T C 2: 122,524,807 I555T probably benign Het
Gpat2 G C 2: 127,431,918 G294R possibly damaging Het
Gpat3 A T 5: 100,893,144 M357L probably benign Het
Gpr179 A G 11: 97,337,147 V1394A possibly damaging Het
Grn T A 11: 102,436,795 probably benign Het
H2-Q6 G A 17: 35,428,383 probably null Het
Igsf3 A G 3: 101,435,648 T514A probably benign Het
Il1r1 A G 1: 40,313,335 D558G possibly damaging Het
Irx4 T C 13: 73,267,713 M207T possibly damaging Het
Kap T C 6: 133,851,957 I54V probably benign Het
Kdm2b G A 5: 122,934,778 R340C probably damaging Het
Lipo3 T A 19: 33,556,431 M334L probably benign Het
Lmbrd1 C T 1: 24,706,034 L152F probably damaging Het
Ltbp1 G A 17: 75,359,457 V1382I probably damaging Het
Map3k4 C T 17: 12,249,583 D1008N possibly damaging Het
Mcf2l T C 8: 12,879,912 probably benign Het
Mecom T G 3: 29,997,726 D180A probably damaging Het
Meis1 T C 11: 18,941,741 D269G probably benign Het
Myh7 A C 14: 54,988,894 S430A probably benign Het
Myo1h A G 5: 114,336,264 I439V probably damaging Het
Nat1 T C 8: 67,491,482 V170A possibly damaging Het
Nlrp12 A G 7: 3,234,043 L742P probably damaging Het
Nlrp4c A G 7: 6,066,053 T318A probably benign Het
Olfr1297 T A 2: 111,621,186 N296I probably benign Het
Olfr1425 T A 19: 12,074,363 I90F probably damaging Het
Olfr632 A G 7: 103,937,823 I148V probably benign Het
Olfr952 G T 9: 39,426,234 T279N probably damaging Het
Olfr955 A T 9: 39,470,630 L32Q probably damaging Het
Otop3 A G 11: 115,345,072 E529G probably damaging Het
Parp6 T C 9: 59,623,939 Y35H probably damaging Het
Pcdhb4 A C 18: 37,308,021 D128A probably damaging Het
Phldb2 C T 16: 45,748,750 D1249N probably damaging Het
Ptpn12 T A 5: 20,987,468 K765* probably null Het
Ptprb T A 10: 116,347,007 Y1529* probably null Het
Ptprc A T 1: 138,078,451 Y798N possibly damaging Het
Sdk2 G A 11: 113,832,265 T1300I probably damaging Het
Sptbn2 G A 19: 4,732,496 V487I possibly damaging Het
Sptbn5 A G 2: 120,046,269 probably benign Het
Stard9 T C 2: 120,666,407 probably null Het
Tmem135 A T 7: 89,144,670 I388N probably damaging Het
Top3a A T 11: 60,749,459 I446N probably benign Het
Trpv1 T C 11: 73,246,036 S482P probably damaging Het
Ugt3a1 C T 15: 9,306,455 A230V probably benign Het
Vmn2r15 A C 5: 109,293,226 Y255* probably null Het
Vmn2r60 A G 7: 42,116,471 M1V probably null Het
Vmn2r87 A G 10: 130,479,000 V239A probably damaging Het
Vwce T A 19: 10,659,592 C679* probably null Het
Zfp385b C T 2: 77,415,841 A281T probably benign Het
Zfp398 T G 6: 47,866,595 L395W probably damaging Het
Zfp442 C T 2: 150,451,401 probably null Het
Zfp606 A G 7: 12,492,944 S331G probably benign Het
Zfp882 A G 8: 71,914,640 H437R probably damaging Het
Other mutations in Srpk1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01583:Srpk1 APN 17 28606317 missense probably damaging 1.00
IGL01792:Srpk1 APN 17 28599467 splice site probably benign
IGL03153:Srpk1 APN 17 28592266 missense possibly damaging 0.57
H8562:Srpk1 UTSW 17 28602733 missense probably benign 0.32
R0481:Srpk1 UTSW 17 28590244 splice site probably benign
R1160:Srpk1 UTSW 17 28599774 missense probably benign 0.05
R2188:Srpk1 UTSW 17 28594189 missense probably damaging 1.00
R4640:Srpk1 UTSW 17 28608724 missense probably benign
R4716:Srpk1 UTSW 17 28622008 missense probably benign 0.16
R4880:Srpk1 UTSW 17 28591225 missense probably damaging 0.98
R5458:Srpk1 UTSW 17 28599472 splice site probably null
R5533:Srpk1 UTSW 17 28602759 missense probably damaging 1.00
R6766:Srpk1 UTSW 17 28602753 missense possibly damaging 0.85
R7483:Srpk1 UTSW 17 28594218 missense probably benign 0.11
X0058:Srpk1 UTSW 17 28602835 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACACTTTTAGTCTTTGGCAGAGC -3'
(R):5'- GCACATCACCAAGTTGAAGC -3'

Sequencing Primer
(F):5'- TTCACCTAGGATGCCCAATGG -3'
(R):5'- CAAGTTGAAGCCTTGGGGTC -3'
Posted On2018-05-04