Incidental Mutation 'R6383:Vwce'
ID515477
Institutional Source Beutler Lab
Gene Symbol Vwce
Ensembl Gene ENSMUSG00000043789
Gene Namevon Willebrand factor C and EGF domains
Synonyms1300015B04Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.058) question?
Stock #R6383 (G1)
Quality Score225.009
Status Validated
Chromosome19
Chromosomal Location10634233-10665210 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) T to A at 10659592 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Stop codon at position 679 (C679*)
Ref Sequence ENSEMBL: ENSMUSP00000056958 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000055115]
Predicted Effect probably null
Transcript: ENSMUST00000055115
AA Change: C679*
SMART Domains Protein: ENSMUSP00000056958
Gene: ENSMUSG00000043789
AA Change: C679*

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
EGF 70 98 2.2e1 SMART
EGF_CA 142 180 6.91e-9 SMART
EGF_CA 181 219 7.75e-12 SMART
EGF_CA 220 262 1.11e-12 SMART
low complexity region 294 312 N/A INTRINSIC
low complexity region 335 353 N/A INTRINSIC
VWC 378 432 2.91e-6 SMART
VWC 435 488 4.58e-4 SMART
VWC 493 551 2.06e-6 SMART
VWC 560 617 9.74e-8 SMART
VWC 621 676 1.35e-10 SMART
VWC 679 725 2.58e-1 SMART
low complexity region 761 772 N/A INTRINSIC
low complexity region 889 903 N/A INTRINSIC
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 97.9%
Validation Efficiency 97% (73/75)
Allele List at MGI
Other mutations in this stock
Total: 76 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca12 A T 1: 71,247,184 M2497K probably benign Het
Abtb2 C T 2: 103,567,376 T217I probably damaging Het
Adam29 T A 8: 55,871,508 N637I probably damaging Het
Adgb T A 10: 10,450,028 E59V probably damaging Het
Adh7 C T 3: 138,228,017 R312C probably benign Het
Adprh A G 16: 38,447,452 I157T probably damaging Het
Ap2b1 T C 11: 83,346,825 S572P probably damaging Het
Asic1 T C 15: 99,698,880 L519P probably damaging Het
Atp2a2 G C 5: 122,501,649 L13V probably benign Het
Bst2 A T 8: 71,537,288 I47N possibly damaging Het
Cacng6 G A 7: 3,424,993 probably null Het
Cenpe A G 3: 135,251,528 E1849G probably damaging Het
Cep295 T A 9: 15,332,754 T213S probably damaging Het
Chia1 A G 3: 106,131,811 T406A probably benign Het
Chmp4c G T 3: 10,367,217 K62N probably damaging Het
Cldn15 A G 5: 136,968,125 T7A probably benign Het
Cmpk2 T A 12: 26,478,020 M412K probably benign Het
Cnnm1 T C 19: 43,465,266 probably null Het
Cubn A C 2: 13,427,835 probably null Het
Dopey2 T C 16: 93,782,248 V1668A possibly damaging Het
Erg28 T A 12: 85,816,429 Y77F probably damaging Het
F830045P16Rik C T 2: 129,536,438 A9T probably benign Het
Gli3 A G 13: 15,723,555 D740G probably damaging Het
Gm13128 A T 4: 144,333,147 *476L probably null Het
Gm14085 T C 2: 122,524,807 I555T probably benign Het
Gpat2 G C 2: 127,431,918 G294R possibly damaging Het
Gpat3 A T 5: 100,893,144 M357L probably benign Het
Gpr179 A G 11: 97,337,147 V1394A possibly damaging Het
Grn T A 11: 102,436,795 probably benign Het
H2-Q6 G A 17: 35,428,383 probably null Het
Igsf3 A G 3: 101,435,648 T514A probably benign Het
Il1r1 A G 1: 40,313,335 D558G possibly damaging Het
Irx4 T C 13: 73,267,713 M207T possibly damaging Het
Kap T C 6: 133,851,957 I54V probably benign Het
Kdm2b G A 5: 122,934,778 R340C probably damaging Het
Lipo3 T A 19: 33,556,431 M334L probably benign Het
Lmbrd1 C T 1: 24,706,034 L152F probably damaging Het
Ltbp1 G A 17: 75,359,457 V1382I probably damaging Het
Map3k4 C T 17: 12,249,583 D1008N possibly damaging Het
Mcf2l T C 8: 12,879,912 probably benign Het
Mecom T G 3: 29,997,726 D180A probably damaging Het
Meis1 T C 11: 18,941,741 D269G probably benign Het
Myh7 A C 14: 54,988,894 S430A probably benign Het
Myo1h A G 5: 114,336,264 I439V probably damaging Het
Nat1 T C 8: 67,491,482 V170A possibly damaging Het
Nlrp12 A G 7: 3,234,043 L742P probably damaging Het
Nlrp4c A G 7: 6,066,053 T318A probably benign Het
Olfr1297 T A 2: 111,621,186 N296I probably benign Het
Olfr1425 T A 19: 12,074,363 I90F probably damaging Het
Olfr632 A G 7: 103,937,823 I148V probably benign Het
Olfr952 G T 9: 39,426,234 T279N probably damaging Het
Olfr955 A T 9: 39,470,630 L32Q probably damaging Het
Otop3 A G 11: 115,345,072 E529G probably damaging Het
Parp6 T C 9: 59,623,939 Y35H probably damaging Het
Pcdhb4 A C 18: 37,308,021 D128A probably damaging Het
Phldb2 C T 16: 45,748,750 D1249N probably damaging Het
Ptpn12 T A 5: 20,987,468 K765* probably null Het
Ptprb T A 10: 116,347,007 Y1529* probably null Het
Ptprc A T 1: 138,078,451 Y798N possibly damaging Het
Sdk2 G A 11: 113,832,265 T1300I probably damaging Het
Sptbn2 G A 19: 4,732,496 V487I possibly damaging Het
Sptbn5 A G 2: 120,046,269 probably benign Het
Srpk1 A G 17: 28,590,062 S648P probably damaging Het
Stard9 T C 2: 120,666,407 probably null Het
Tmem135 A T 7: 89,144,670 I388N probably damaging Het
Top3a A T 11: 60,749,459 I446N probably benign Het
Trpv1 T C 11: 73,246,036 S482P probably damaging Het
Ugt3a1 C T 15: 9,306,455 A230V probably benign Het
Vmn2r15 A C 5: 109,293,226 Y255* probably null Het
Vmn2r60 A G 7: 42,116,471 M1V probably null Het
Vmn2r87 A G 10: 130,479,000 V239A probably damaging Het
Zfp385b C T 2: 77,415,841 A281T probably benign Het
Zfp398 T G 6: 47,866,595 L395W probably damaging Het
Zfp442 C T 2: 150,451,401 probably null Het
Zfp606 A G 7: 12,492,944 S331G probably benign Het
Zfp882 A G 8: 71,914,640 H437R probably damaging Het
Other mutations in Vwce
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00429:Vwce APN 19 10664511 unclassified probably null
IGL01358:Vwce APN 19 10664409 missense possibly damaging 0.86
IGL02330:Vwce APN 19 10646801 missense possibly damaging 0.96
IGL02477:Vwce APN 19 10664618 unclassified probably null
IGL02551:Vwce APN 19 10645036 missense possibly damaging 0.71
IGL02606:Vwce APN 19 10655348 splice site probably benign
IGL02633:Vwce APN 19 10648494 missense probably damaging 0.98
IGL02656:Vwce APN 19 10664352 missense probably benign
IGL02884:Vwce APN 19 10646579 missense possibly damaging 0.53
IGL02973:Vwce APN 19 10655400 nonsense probably null
IGL03038:Vwce APN 19 10646671 missense possibly damaging 0.86
IGL03329:Vwce APN 19 10659996 missense possibly damaging 0.73
PIT4403001:Vwce UTSW 19 10638097 missense possibly damaging 0.53
PIT4431001:Vwce UTSW 19 10664582 missense possibly damaging 0.53
PIT4519001:Vwce UTSW 19 10664582 missense possibly damaging 0.53
R0042:Vwce UTSW 19 10646813 missense probably benign
R0081:Vwce UTSW 19 10664089 critical splice acceptor site probably null
R0142:Vwce UTSW 19 10664612 missense probably damaging 0.97
R0165:Vwce UTSW 19 10659973 splice site probably benign
R0948:Vwce UTSW 19 10653077 missense probably damaging 1.00
R1053:Vwce UTSW 19 10664099 missense probably benign 0.18
R1505:Vwce UTSW 19 10664244 missense probably benign
R1623:Vwce UTSW 19 10646744 nonsense probably null
R1672:Vwce UTSW 19 10653095 missense possibly damaging 0.92
R1882:Vwce UTSW 19 10638156 missense possibly damaging 0.53
R3849:Vwce UTSW 19 10646905 missense probably damaging 0.97
R4292:Vwce UTSW 19 10659632 missense probably benign 0.00
R4293:Vwce UTSW 19 10659632 missense probably benign 0.00
R4531:Vwce UTSW 19 10664346 missense probably benign 0.01
R4678:Vwce UTSW 19 10664648 missense possibly damaging 0.86
R4720:Vwce UTSW 19 10648467 missense possibly damaging 0.85
R4737:Vwce UTSW 19 10650579 missense probably benign 0.33
R4864:Vwce UTSW 19 10650636 missense probably benign 0.01
R4916:Vwce UTSW 19 10646879 missense probably damaging 0.98
R4939:Vwce UTSW 19 10645050 missense probably damaging 0.98
R5605:Vwce UTSW 19 10658038 missense possibly damaging 0.95
R5735:Vwce UTSW 19 10647067 missense probably benign 0.08
R5780:Vwce UTSW 19 10650619 missense probably damaging 1.00
R6158:Vwce UTSW 19 10644221 missense possibly damaging 0.91
R6920:Vwce UTSW 19 10664693 missense probably benign
R7201:Vwce UTSW 19 10638115 missense possibly damaging 0.72
R7276:Vwce UTSW 19 10664174 missense possibly damaging 0.53
R7423:Vwce UTSW 19 10664340 missense probably benign 0.02
R7474:Vwce UTSW 19 10646941 missense possibly damaging 0.93
R7843:Vwce UTSW 19 10664283 missense probably benign 0.01
R7926:Vwce UTSW 19 10664283 missense probably benign 0.01
RF020:Vwce UTSW 19 10653085 missense probably damaging 1.00
X0018:Vwce UTSW 19 10656662 missense possibly damaging 0.86
Z1177:Vwce UTSW 19 10646863 missense possibly damaging 0.70
Predicted Primers PCR Primer
(F):5'- ACCGTACTAGCTGTCCTCAGTG -3'
(R):5'- GCCAGAGACAAGGGTACTTTG -3'

Sequencing Primer
(F):5'- CTATGTTCTACAGCTGGGCTCAG -3'
(R):5'- ACAAGGGTACTTTGAGAGTTCATG -3'
Posted On2018-05-04