Incidental Mutation 'R6384:Ttc16'
ID515485
Institutional Source Beutler Lab
Gene Symbol Ttc16
Ensembl Gene ENSMUSG00000039021
Gene Nametetratricopeptide repeat domain 16
Synonyms1200002K10Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.141) question?
Stock #R6384 (G1)
Quality Score225.009
Status Not validated
Chromosome2
Chromosomal Location32757026-32775633 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 32767549 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Threonine at position 512 (A512T)
Ref Sequence ENSEMBL: ENSMUSP00000124031 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000066478] [ENSMUST00000091059] [ENSMUST00000125891] [ENSMUST00000161089] [ENSMUST00000161430] [ENSMUST00000161950]
Predicted Effect probably damaging
Transcript: ENSMUST00000066478
AA Change: A455T

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000068977
Gene: ENSMUSG00000039021
AA Change: A455T

DomainStartEndE-ValueType
TPR 18 51 2.26e-3 SMART
TPR 52 85 4.09e-1 SMART
TPR 93 126 8.3e-2 SMART
TPR 161 194 4.44e1 SMART
TPR 208 241 3.69e1 SMART
TPR 242 275 1.08e1 SMART
Blast:TPR 288 321 2e-10 BLAST
TPR 322 355 1.02e-1 SMART
TPR 363 396 7.27e0 SMART
Blast:TPR 397 430 2e-12 BLAST
low complexity region 539 554 N/A INTRINSIC
low complexity region 565 577 N/A INTRINSIC
low complexity region 629 640 N/A INTRINSIC
low complexity region 725 750 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000091059
AA Change: A512T

PolyPhen 2 Score 0.956 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000088585
Gene: ENSMUSG00000039021
AA Change: A512T

DomainStartEndE-ValueType
TPR 75 108 2.26e-3 SMART
TPR 109 142 4.09e-1 SMART
TPR 150 183 8.3e-2 SMART
TPR 218 251 4.44e1 SMART
TPR 265 298 3.69e1 SMART
TPR 299 332 1.08e1 SMART
Blast:TPR 345 378 2e-10 BLAST
TPR 379 412 1.02e-1 SMART
TPR 420 453 7.27e0 SMART
Blast:TPR 454 487 2e-12 BLAST
low complexity region 631 644 N/A INTRINSIC
low complexity region 666 679 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000125891
Predicted Effect probably damaging
Transcript: ENSMUST00000161089
AA Change: A455T

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000124915
Gene: ENSMUSG00000039021
AA Change: A455T

DomainStartEndE-ValueType
TPR 18 51 2.26e-3 SMART
TPR 52 85 4.09e-1 SMART
TPR 93 126 8.3e-2 SMART
TPR 161 194 4.44e1 SMART
TPR 208 241 3.69e1 SMART
TPR 242 275 1.08e1 SMART
Blast:TPR 288 321 2e-10 BLAST
TPR 322 355 1.02e-1 SMART
TPR 363 396 7.27e0 SMART
Blast:TPR 397 430 2e-12 BLAST
low complexity region 539 554 N/A INTRINSIC
low complexity region 565 577 N/A INTRINSIC
low complexity region 629 640 N/A INTRINSIC
low complexity region 725 750 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000161430
AA Change: A512T

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000124031
Gene: ENSMUSG00000039021
AA Change: A512T

DomainStartEndE-ValueType
TPR 75 108 2.26e-3 SMART
TPR 109 142 4.09e-1 SMART
TPR 150 183 8.3e-2 SMART
TPR 218 251 4.44e1 SMART
TPR 265 298 3.69e1 SMART
TPR 299 332 1.08e1 SMART
Blast:TPR 345 378 2e-10 BLAST
TPR 379 412 1.02e-1 SMART
TPR 420 453 7.27e0 SMART
Blast:TPR 454 487 2e-12 BLAST
low complexity region 596 611 N/A INTRINSIC
low complexity region 622 634 N/A INTRINSIC
low complexity region 686 697 N/A INTRINSIC
low complexity region 782 807 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000161950
AA Change: A455T

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000123927
Gene: ENSMUSG00000039021
AA Change: A455T

DomainStartEndE-ValueType
TPR 18 51 2.26e-3 SMART
TPR 52 85 4.09e-1 SMART
TPR 93 126 8.3e-2 SMART
TPR 161 194 4.44e1 SMART
TPR 208 241 3.69e1 SMART
TPR 242 275 1.08e1 SMART
Blast:TPR 288 321 2e-10 BLAST
TPR 322 355 1.02e-1 SMART
TPR 363 396 7.27e0 SMART
Blast:TPR 397 430 2e-12 BLAST
low complexity region 539 554 N/A INTRINSIC
low complexity region 565 577 N/A INTRINSIC
low complexity region 629 640 N/A INTRINSIC
low complexity region 725 750 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 98.2%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acad10 T A 5: 121,652,003 T97S probably benign Het
Adam34 T A 8: 43,650,799 D603V probably benign Het
Adamts5 C T 16: 85,862,828 V859I probably benign Het
Alb T A 5: 90,472,640 D536E possibly damaging Het
Amz2 A G 11: 109,429,034 Y82C probably damaging Het
Asxl1 T C 2: 153,391,824 probably null Het
Bach1 C T 16: 87,719,857 Q429* probably null Het
Bcl6 A G 16: 23,974,865 Y111H probably damaging Het
Ccnj T C 19: 40,846,007 V338A probably benign Het
Cdca3 C T 6: 124,832,419 P174L probably damaging Het
Cdk17 T C 10: 93,211,965 L25P probably damaging Het
Cdr2 G A 7: 120,982,128 probably null Het
Cyp2c38 A T 19: 39,392,293 probably null Het
Ednra T C 8: 77,689,094 N175D probably damaging Het
Elp3 T C 14: 65,560,211 Y337C probably damaging Het
Eml2 G A 7: 19,201,163 V432I probably damaging Het
Eps15l1 A T 8: 72,368,710 probably null Het
F11r A G 1: 171,460,940 N117S probably benign Het
Foxp2 C T 6: 15,437,948 T716I probably damaging Het
Gnaq A G 19: 16,316,013 probably null Het
Gpat2 G C 2: 127,431,918 G294R possibly damaging Het
Gpr158 T C 2: 21,826,288 M733T probably damaging Het
Hdac7 G A 15: 97,811,506 Q48* probably null Het
Hmga2 G A 10: 120,370,707 probably benign Het
Itgb7 A G 15: 102,224,451 V142A probably benign Het
Kif5a T C 10: 127,242,775 N334D probably damaging Het
Lrrc47 T C 4: 154,015,860 S298P probably benign Het
Map3k1 A T 13: 111,750,530 S1415R probably damaging Het
Mdn1 T A 4: 32,670,607 L424Q probably damaging Het
Numb A C 12: 83,803,974 L154R probably damaging Het
Olfr1076 A G 2: 86,509,037 K193E probably benign Het
Olfr944 T C 9: 39,217,978 V207A probably benign Het
Pdcd5 G T 7: 35,646,909 A92E possibly damaging Het
Pdcl2 C T 5: 76,331,008 probably null Het
Rbfa T C 18: 80,192,781 Y251C probably damaging Het
Rgsl1 G A 1: 153,827,545 T120I possibly damaging Het
Serpina3g A G 12: 104,240,396 Q152R probably null Het
Setx T C 2: 29,173,558 S2289P probably damaging Het
Slc6a16 A G 7: 45,257,593 probably null Het
Slco1a6 C T 6: 142,109,379 D280N probably benign Het
Syde2 T A 3: 145,998,813 Y240N probably damaging Het
Synpo2 G A 3: 123,113,049 Q873* probably null Het
Tlr2 A G 3: 83,836,994 V594A probably benign Het
Tubb5 T C 17: 35,838,046 E3G probably damaging Het
Vmn2r112 T C 17: 22,605,155 Y464H probably damaging Het
Xcr1 T A 9: 123,855,782 H305L probably damaging Het
Yars T G 4: 129,196,978 probably null Het
Other mutations in Ttc16
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00952:Ttc16 APN 2 32770247 missense probably damaging 1.00
IGL02931:Ttc16 APN 2 32771927 missense probably damaging 1.00
IGL03143:Ttc16 APN 2 32774445 missense possibly damaging 0.86
IGL03206:Ttc16 APN 2 32771885 unclassified probably null
IGL03310:Ttc16 APN 2 32762397 unclassified probably benign
P0033:Ttc16 UTSW 2 32762574 missense probably benign 0.00
R0909:Ttc16 UTSW 2 32762868 missense probably benign 0.08
R1085:Ttc16 UTSW 2 32775080 missense possibly damaging 0.83
R1659:Ttc16 UTSW 2 32762535 missense probably benign 0.15
R1752:Ttc16 UTSW 2 32772150 missense probably damaging 0.96
R2408:Ttc16 UTSW 2 32768008 missense probably benign 0.00
R3835:Ttc16 UTSW 2 32769310 missense probably damaging 0.99
R4576:Ttc16 UTSW 2 32770059 missense probably benign 0.02
R4590:Ttc16 UTSW 2 32773741 missense probably damaging 1.00
R4630:Ttc16 UTSW 2 32775377 start gained probably benign
R5081:Ttc16 UTSW 2 32767976 missense probably damaging 1.00
R5128:Ttc16 UTSW 2 32762997 missense probably benign 0.31
R5642:Ttc16 UTSW 2 32775336 missense probably damaging 0.99
R5704:Ttc16 UTSW 2 32769125 missense probably damaging 1.00
R6723:Ttc16 UTSW 2 32768037 missense possibly damaging 0.66
R7103:Ttc16 UTSW 2 32774428 missense probably benign 0.00
R7295:Ttc16 UTSW 2 32774425 missense probably null 0.02
R7570:Ttc16 UTSW 2 32768968 missense probably damaging 1.00
R8074:Ttc16 UTSW 2 32774123 unclassified probably benign
Z1088:Ttc16 UTSW 2 32769333 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CAGTGCAAGCCCTTCAGAACAG -3'
(R):5'- TCAGAACTGTCCTGTCTGCC -3'

Sequencing Primer
(F):5'- CTTCAGAACAGCTGGACCAGAG -3'
(R):5'- CACTGGGGAGCTGTCCATTG -3'
Posted On2018-05-04