Incidental Mutation 'R6384:Synpo2'
ID515490
Institutional Source Beutler Lab
Gene Symbol Synpo2
Ensembl Gene ENSMUSG00000050315
Gene Namesynaptopodin 2
Synonyms1110069I04Rik, Myo, 9530006G20Rik, 2310068J10Rik, myopodin
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6384 (G1)
Quality Score225.009
Status Not validated
Chromosome3
Chromosomal Location123076519-123236149 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) G to A at 123113049 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Stop codon at position 873 (Q873*)
Ref Sequence ENSEMBL: ENSMUSP00000142508 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000051443] [ENSMUST00000106426] [ENSMUST00000106427] [ENSMUST00000184590] [ENSMUST00000198584]
Predicted Effect probably null
Transcript: ENSMUST00000051443
AA Change: Q543*
SMART Domains Protein: ENSMUSP00000051570
Gene: ENSMUSG00000050315
AA Change: Q543*

DomainStartEndE-ValueType
PDZ 15 88 6.51e-14 SMART
low complexity region 339 357 N/A INTRINSIC
internal_repeat_2 377 398 1.92e-5 PROSPERO
low complexity region 406 424 N/A INTRINSIC
low complexity region 434 448 N/A INTRINSIC
internal_repeat_1 477 503 1.04e-7 PROSPERO
internal_repeat_2 478 499 1.92e-5 PROSPERO
low complexity region 534 549 N/A INTRINSIC
low complexity region 609 621 N/A INTRINSIC
low complexity region 628 651 N/A INTRINSIC
low complexity region 740 777 N/A INTRINSIC
low complexity region 802 814 N/A INTRINSIC
low complexity region 846 854 N/A INTRINSIC
internal_repeat_1 858 884 1.04e-7 PROSPERO
low complexity region 941 950 N/A INTRINSIC
low complexity region 1034 1051 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000106426
AA Change: Q873*
SMART Domains Protein: ENSMUSP00000102034
Gene: ENSMUSG00000050315
AA Change: Q873*

DomainStartEndE-ValueType
PDZ 15 88 6.51e-14 SMART
low complexity region 339 357 N/A INTRINSIC
internal_repeat_2 377 398 4.61e-5 PROSPERO
low complexity region 406 424 N/A INTRINSIC
low complexity region 434 448 N/A INTRINSIC
internal_repeat_1 477 503 2.92e-7 PROSPERO
internal_repeat_2 478 499 4.61e-5 PROSPERO
low complexity region 534 549 N/A INTRINSIC
low complexity region 609 621 N/A INTRINSIC
low complexity region 628 651 N/A INTRINSIC
low complexity region 740 777 N/A INTRINSIC
low complexity region 802 814 N/A INTRINSIC
low complexity region 846 854 N/A INTRINSIC
internal_repeat_1 858 884 2.92e-7 PROSPERO
low complexity region 941 950 N/A INTRINSIC
low complexity region 1034 1051 N/A INTRINSIC
low complexity region 1196 1211 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000106427
AA Change: Q873*
SMART Domains Protein: ENSMUSP00000102035
Gene: ENSMUSG00000050315
AA Change: Q873*

DomainStartEndE-ValueType
PDZ 15 88 6.51e-14 SMART
low complexity region 339 357 N/A INTRINSIC
internal_repeat_2 377 398 6.19e-5 PROSPERO
low complexity region 406 424 N/A INTRINSIC
low complexity region 434 448 N/A INTRINSIC
internal_repeat_1 477 503 4.33e-7 PROSPERO
internal_repeat_2 478 499 6.19e-5 PROSPERO
low complexity region 534 549 N/A INTRINSIC
low complexity region 609 621 N/A INTRINSIC
low complexity region 628 651 N/A INTRINSIC
low complexity region 740 777 N/A INTRINSIC
low complexity region 802 814 N/A INTRINSIC
low complexity region 846 854 N/A INTRINSIC
internal_repeat_1 858 884 4.33e-7 PROSPERO
low complexity region 941 950 N/A INTRINSIC
low complexity region 1137 1152 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000139160
SMART Domains Protein: ENSMUSP00000123396
Gene: ENSMUSG00000050315

DomainStartEndE-ValueType
low complexity region 155 170 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000184590
SMART Domains Protein: ENSMUSP00000142426
Gene: ENSMUSG00000050315

DomainStartEndE-ValueType
low complexity region 48 57 N/A INTRINSIC
low complexity region 141 158 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000198584
AA Change: Q873*
SMART Domains Protein: ENSMUSP00000142508
Gene: ENSMUSG00000050315
AA Change: Q873*

DomainStartEndE-ValueType
PDZ 15 88 6.51e-14 SMART
low complexity region 339 357 N/A INTRINSIC
internal_repeat_2 377 398 1.92e-5 PROSPERO
low complexity region 406 424 N/A INTRINSIC
low complexity region 434 448 N/A INTRINSIC
internal_repeat_1 477 503 1.04e-7 PROSPERO
internal_repeat_2 478 499 1.92e-5 PROSPERO
low complexity region 534 549 N/A INTRINSIC
low complexity region 609 621 N/A INTRINSIC
low complexity region 628 651 N/A INTRINSIC
low complexity region 740 777 N/A INTRINSIC
low complexity region 802 814 N/A INTRINSIC
low complexity region 846 854 N/A INTRINSIC
internal_repeat_1 858 884 1.04e-7 PROSPERO
low complexity region 941 950 N/A INTRINSIC
low complexity region 1034 1051 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 98.2%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acad10 T A 5: 121,652,003 T97S probably benign Het
Adam34 T A 8: 43,650,799 D603V probably benign Het
Adamts5 C T 16: 85,862,828 V859I probably benign Het
Alb T A 5: 90,472,640 D536E possibly damaging Het
Amz2 A G 11: 109,429,034 Y82C probably damaging Het
Asxl1 T C 2: 153,391,824 probably null Het
Bach1 C T 16: 87,719,857 Q429* probably null Het
Bcl6 A G 16: 23,974,865 Y111H probably damaging Het
Ccnj T C 19: 40,846,007 V338A probably benign Het
Cdca3 C T 6: 124,832,419 P174L probably damaging Het
Cdk17 T C 10: 93,211,965 L25P probably damaging Het
Cdr2 G A 7: 120,982,128 probably null Het
Cyp2c38 A T 19: 39,392,293 probably null Het
Ednra T C 8: 77,689,094 N175D probably damaging Het
Elp3 T C 14: 65,560,211 Y337C probably damaging Het
Eml2 G A 7: 19,201,163 V432I probably damaging Het
Eps15l1 A T 8: 72,368,710 probably null Het
F11r A G 1: 171,460,940 N117S probably benign Het
Foxp2 C T 6: 15,437,948 T716I probably damaging Het
Gnaq A G 19: 16,316,013 probably null Het
Gpat2 G C 2: 127,431,918 G294R possibly damaging Het
Gpr158 T C 2: 21,826,288 M733T probably damaging Het
Hdac7 G A 15: 97,811,506 Q48* probably null Het
Hmga2 G A 10: 120,370,707 probably benign Het
Itgb7 A G 15: 102,224,451 V142A probably benign Het
Kif5a T C 10: 127,242,775 N334D probably damaging Het
Lrrc47 T C 4: 154,015,860 S298P probably benign Het
Map3k1 A T 13: 111,750,530 S1415R probably damaging Het
Mdn1 T A 4: 32,670,607 L424Q probably damaging Het
Numb A C 12: 83,803,974 L154R probably damaging Het
Olfr1076 A G 2: 86,509,037 K193E probably benign Het
Olfr944 T C 9: 39,217,978 V207A probably benign Het
Pdcd5 G T 7: 35,646,909 A92E possibly damaging Het
Pdcl2 C T 5: 76,331,008 probably null Het
Rbfa T C 18: 80,192,781 Y251C probably damaging Het
Rgsl1 G A 1: 153,827,545 T120I possibly damaging Het
Serpina3g A G 12: 104,240,396 Q152R probably null Het
Setx T C 2: 29,173,558 S2289P probably damaging Het
Slc6a16 A G 7: 45,257,593 probably null Het
Slco1a6 C T 6: 142,109,379 D280N probably benign Het
Syde2 T A 3: 145,998,813 Y240N probably damaging Het
Tlr2 A G 3: 83,836,994 V594A probably benign Het
Ttc16 C T 2: 32,767,549 A512T probably damaging Het
Tubb5 T C 17: 35,838,046 E3G probably damaging Het
Vmn2r112 T C 17: 22,605,155 Y464H probably damaging Het
Xcr1 T A 9: 123,855,782 H305L probably damaging Het
Yars T G 4: 129,196,978 probably null Het
Other mutations in Synpo2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00333:Synpo2 APN 3 123113210 missense probably damaging 1.00
IGL00742:Synpo2 APN 3 123113876 missense probably damaging 1.00
IGL01890:Synpo2 APN 3 123112497 missense probably damaging 1.00
IGL02268:Synpo2 APN 3 123116983 missense probably damaging 1.00
IGL02323:Synpo2 APN 3 123117534 missense probably benign 0.00
IGL02745:Synpo2 APN 3 123113612 missense probably damaging 1.00
IGL03001:Synpo2 APN 3 123079955 missense probably benign 0.00
IGL03177:Synpo2 APN 3 123121215 missense probably damaging 1.00
IGL03336:Synpo2 APN 3 123114179 missense possibly damaging 0.60
R0086:Synpo2 UTSW 3 123117104 nonsense probably null
R0126:Synpo2 UTSW 3 123079862 missense possibly damaging 0.71
R0227:Synpo2 UTSW 3 123113793 missense probably benign 0.02
R0284:Synpo2 UTSW 3 123079734 nonsense probably null
R0388:Synpo2 UTSW 3 123079897 missense probably benign
R0457:Synpo2 UTSW 3 123112772 missense probably damaging 1.00
R0483:Synpo2 UTSW 3 123114332 missense probably damaging 1.00
R0615:Synpo2 UTSW 3 123117287 missense probably damaging 1.00
R0646:Synpo2 UTSW 3 123114449 missense probably damaging 1.00
R0666:Synpo2 UTSW 3 123114059 missense probably damaging 0.98
R0743:Synpo2 UTSW 3 123112706 missense probably benign 0.02
R0791:Synpo2 UTSW 3 123113186 missense probably benign
R1531:Synpo2 UTSW 3 123117666 missense probably benign 0.03
R1587:Synpo2 UTSW 3 123114398 missense probably damaging 0.98
R1717:Synpo2 UTSW 3 123112554 missense probably damaging 1.00
R1807:Synpo2 UTSW 3 123080257 missense possibly damaging 0.71
R2114:Synpo2 UTSW 3 123079888 missense probably benign 0.01
R2987:Synpo2 UTSW 3 123116973 missense probably damaging 1.00
R3019:Synpo2 UTSW 3 123113579 missense probably damaging 1.00
R3939:Synpo2 UTSW 3 123114590 missense probably damaging 1.00
R4050:Synpo2 UTSW 3 123114278 missense possibly damaging 0.81
R4119:Synpo2 UTSW 3 123117150 missense probably damaging 1.00
R4669:Synpo2 UTSW 3 123113063 missense probably damaging 1.00
R4724:Synpo2 UTSW 3 123114291 missense probably damaging 1.00
R4825:Synpo2 UTSW 3 123114419 missense probably damaging 0.98
R5152:Synpo2 UTSW 3 123235901 critical splice donor site probably null
R5292:Synpo2 UTSW 3 123114060 missense possibly damaging 0.51
R5396:Synpo2 UTSW 3 123117682 nonsense probably null
R5701:Synpo2 UTSW 3 123080230 missense probably damaging 1.00
R5712:Synpo2 UTSW 3 123121210 missense probably damaging 1.00
R5730:Synpo2 UTSW 3 123114119 missense probably benign 0.04
R5879:Synpo2 UTSW 3 123114297 missense probably damaging 1.00
R5979:Synpo2 UTSW 3 123117411 missense probably damaging 1.00
R6290:Synpo2 UTSW 3 123117052 missense probably damaging 0.98
R6498:Synpo2 UTSW 3 123080232 synonymous probably null
R7123:Synpo2 UTSW 3 123113186 missense probably benign
R7153:Synpo2 UTSW 3 123112404 makesense probably null
R7233:Synpo2 UTSW 3 123117684 missense probably benign 0.01
R7301:Synpo2 UTSW 3 123114053 missense probably benign 0.10
R7318:Synpo2 UTSW 3 123117319 missense probably benign
R7366:Synpo2 UTSW 3 123114041 missense probably damaging 0.96
R7630:Synpo2 UTSW 3 123080032 missense probably damaging 1.00
R8068:Synpo2 UTSW 3 123117392 missense possibly damaging 0.59
Z1177:Synpo2 UTSW 3 123113010 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GACTTGATAGCAGCCAGTGG -3'
(R):5'- AAAATAGCTCAGCCTGCCGC -3'

Sequencing Primer
(F):5'- CTTGATAGCAGCCAGTGGGTAAG -3'
(R):5'- GAGTGCGCTGAACCTGG -3'
Posted On2018-05-04