Mutagenetix > Incidental Mutation

Incidental Mutation 'R6384:Acad10'

515497

Institutional Source

Beutler Lab

Gene Symbol

Acad10

Ensembl Gene

ENSMUSG00000029456

Gene Name

acyl-Coenzyme A dehydrogenase family, member 10

Synonyms

2410021P16Rik

MMRRC Submission

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R6384 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

121621026-121660514 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 121652003 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Threonine to Serine at position 97 (T97S)

Ref Sequence

ENSEMBL: ENSMUSP00000107400 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000031412] [ENSMUST00000111770]

AlphaFold

Q8K370

Predicted Effect

probably benign
Transcript: ENSMUST00000031412
AA Change: T97S

PolyPhen 2 Score 0.426 (Sensitivity: 0.89; Specificity: 0.90)

SMART Domains

Protein: ENSMUSP00000031412
Gene: ENSMUSG00000029456
AA Change: T97S

Domain	Start	End	E-Value	Type
Pfam:HAD_2	45	231	1.6e-14	PFAM
Pfam:Hydrolase	88	225	5e-8	PFAM
Pfam:APH	287	531	1.8e-52	PFAM
Pfam:Acyl-CoA_dh_N	660	787	1.7e-15	PFAM
Pfam:Acyl-CoA_dh_M	791	892	2.7e-20	PFAM
Pfam:Acyl-CoA_dh_1	904	1055	1.1e-35	PFAM
Pfam:Acyl-CoA_dh_2	919	1037	6.4e-13	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000111770
AA Change: T97S

PolyPhen 2 Score 0.426 (Sensitivity: 0.89; Specificity: 0.90)

SMART Domains

Protein: ENSMUSP00000107400
Gene: ENSMUSG00000029456
AA Change: T97S

Domain	Start	End	E-Value	Type
Pfam:HAD_2	45	231	2.3e-14	PFAM
Pfam:APH	287	523	3.2e-50	PFAM
Pfam:EcKinase	390	504	5.2e-8	PFAM
Pfam:Acyl-CoA_dh_N	660	787	3.4e-14	PFAM
Pfam:Acyl-CoA_dh_M	791	845	2.7e-13	PFAM
Pfam:Acyl-CoA_dh_1	904	1055	9.4e-36	PFAM
Pfam:Acyl-CoA_dh_2	919	1037	1.6e-14	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000133775

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.4%
20x: 98.2%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the acyl-CoA dehydrogenase family of enzymes (ACADs), which participate in the beta-oxidation of fatty acids in mitochondria. The encoded enzyme contains a hydrolase domain at the N-terminal portion, a serine/threonine protein kinase catlytic domain in the central region, and a conserved ACAD domain at the C-terminus. Several alternatively spliced transcript variants of this gene have been described, but the full-length nature of some of these variants has not been determined. [provided by RefSeq, Nov 2008]

Allele List at MGI

Other mutations in this stock

Total: 47 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Adam34	T	A	8: 43,650,799	D603V	probably benign	Het
Adamts5	C	T	16: 85,862,828	V859I	probably benign	Het
Alb	T	A	5: 90,472,640	D536E	possibly damaging	Het
Amz2	A	G	11: 109,429,034	Y82C	probably damaging	Het
Asxl1	T	C	2: 153,391,824		probably null	Het
Bach1	C	T	16: 87,719,857	Q429*	probably null	Het
Bcl6	A	G	16: 23,974,865	Y111H	probably damaging	Het
Ccnj	T	C	19: 40,846,007	V338A	probably benign	Het
Cdca3	C	T	6: 124,832,419	P174L	probably damaging	Het
Cdk17	T	C	10: 93,211,965	L25P	probably damaging	Het
Cdr2	G	A	7: 120,982,128		probably null	Het
Cyp2c38	A	T	19: 39,392,293		probably null	Het
Ednra	T	C	8: 77,689,094	N175D	probably damaging	Het
Elp3	T	C	14: 65,560,211	Y337C	probably damaging	Het
Eml2	G	A	7: 19,201,163	V432I	probably damaging	Het
Eps15l1	A	T	8: 72,368,710		probably null	Het
F11r	A	G	1: 171,460,940	N117S	probably benign	Het
Foxp2	C	T	6: 15,437,948	T716I	probably damaging	Het
Gnaq	A	G	19: 16,316,013		probably null	Het
Gpat2	G	C	2: 127,431,918	G294R	possibly damaging	Het
Gpr158	T	C	2: 21,826,288	M733T	probably damaging	Het
Hdac7	G	A	15: 97,811,506	Q48*	probably null	Het
Hmga2	G	A	10: 120,370,707		probably benign	Het
Itgb7	A	G	15: 102,224,451	V142A	probably benign	Het
Kif5a	T	C	10: 127,242,775	N334D	probably damaging	Het
Lrrc47	T	C	4: 154,015,860	S298P	probably benign	Het
Map3k1	A	T	13: 111,750,530	S1415R	probably damaging	Het
Mdn1	T	A	4: 32,670,607	L424Q	probably damaging	Het
Numb	A	C	12: 83,803,974	L154R	probably damaging	Het
Olfr1076	A	G	2: 86,509,037	K193E	probably benign	Het
Olfr944	T	C	9: 39,217,978	V207A	probably benign	Het
Pdcd5	G	T	7: 35,646,909	A92E	possibly damaging	Het
Pdcl2	C	T	5: 76,331,008		probably null	Het
Rbfa	T	C	18: 80,192,781	Y251C	probably damaging	Het
Rgsl1	G	A	1: 153,827,545	T120I	possibly damaging	Het
Serpina3g	A	G	12: 104,240,396	Q152R	probably null	Het
Setx	T	C	2: 29,173,558	S2289P	probably damaging	Het
Slc6a16	A	G	7: 45,257,593		probably null	Het
Slco1a6	C	T	6: 142,109,379	D280N	probably benign	Het
Syde2	T	A	3: 145,998,813	Y240N	probably damaging	Het
Synpo2	G	A	3: 123,113,049	Q873*	probably null	Het
Tlr2	A	G	3: 83,836,994	V594A	probably benign	Het
Ttc16	C	T	2: 32,767,549	A512T	probably damaging	Het
Tubb5	T	C	17: 35,838,046	E3G	probably damaging	Het
Vmn2r112	T	C	17: 22,605,155	Y464H	probably damaging	Het
Xcr1	T	A	9: 123,855,782	H305L	probably damaging	Het
Yars	T	G	4: 129,196,978		probably null	Het

Other mutations in Acad10

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL02379:Acad10	APN	5	121622043	missense	probably damaging	1.00
IGL02469:Acad10	APN	5	121645459	missense	probably damaging	1.00
IGL02526:Acad10	APN	5	121646860	missense	probably damaging	0.99
IGL02623:Acad10	APN	5	121629930	missense	possibly damaging	0.94
IGL02643:Acad10	APN	5	121631570	missense	probably benign
IGL02685:Acad10	APN	5	121632609	missense	probably benign
IGL03139:Acad10	APN	5	121626082	missense	probably benign
IGL03267:Acad10	APN	5	121637349	missense	probably benign	0.34
P0026:Acad10	UTSW	5	121637352	missense	probably damaging	1.00
R0099:Acad10	UTSW	5	121621290	missense	probably damaging	1.00
R0453:Acad10	UTSW	5	121627382	nonsense	probably null
R1051:Acad10	UTSW	5	121626080	missense	probably damaging	0.97
R1052:Acad10	UTSW	5	121649541	missense	possibly damaging	0.65
R1116:Acad10	UTSW	5	121630751	missense	probably damaging	1.00
R1548:Acad10	UTSW	5	121626040	splice site	probably benign
R1548:Acad10	UTSW	5	121626041	splice site	probably benign
R1571:Acad10	UTSW	5	121621348	missense	probably damaging	0.99
R1592:Acad10	UTSW	5	121645381	missense	probably damaging	0.99
R1741:Acad10	UTSW	5	121647836	missense	probably damaging	1.00
R1789:Acad10	UTSW	5	121631393	missense	possibly damaging	0.67
R1974:Acad10	UTSW	5	121626185	missense	possibly damaging	0.95
R2007:Acad10	UTSW	5	121634751	missense	probably damaging	1.00
R2085:Acad10	UTSW	5	121649460	missense	possibly damaging	0.79
R2351:Acad10	UTSW	5	121629927	missense	probably benign	0.23
R2511:Acad10	UTSW	5	121631567	missense	probably benign	0.02
R2570:Acad10	UTSW	5	121630204	missense	probably damaging	1.00
R3824:Acad10	UTSW	5	121622818	missense	probably benign
R3846:Acad10	UTSW	5	121634686	missense	probably benign	0.19
R4106:Acad10	UTSW	5	121631464	missense	probably damaging	0.98
R4107:Acad10	UTSW	5	121631464	missense	probably damaging	0.98
R4108:Acad10	UTSW	5	121631464	missense	probably damaging	0.98
R5569:Acad10	UTSW	5	121626080	missense	probably damaging	0.97
R5704:Acad10	UTSW	5	121631543	missense	probably benign	0.03
R5845:Acad10	UTSW	5	121626083	missense	probably benign
R5990:Acad10	UTSW	5	121645405	missense	probably damaging	1.00
R6019:Acad10	UTSW	5	121634801	missense	possibly damaging	0.88
R6145:Acad10	UTSW	5	121622033	missense	probably damaging	0.97
R6491:Acad10	UTSW	5	121630157	missense	probably damaging	1.00
R6608:Acad10	UTSW	5	121632492	missense	probably benign	0.02
R6941:Acad10	UTSW	5	121649357	missense	probably damaging	1.00
R7221:Acad10	UTSW	5	121630210	missense	probably damaging	1.00
R7283:Acad10	UTSW	5	121649475	missense	possibly damaging	0.79
R7355:Acad10	UTSW	5	121630717	nonsense	probably null
R7483:Acad10	UTSW	5	121656012	critical splice donor site	probably null
R7553:Acad10	UTSW	5	121639255	missense	probably damaging	1.00
R7721:Acad10	UTSW	5	121646866	splice site	probably null
R8075:Acad10	UTSW	5	121652085	missense	probably benign	0.00
R8400:Acad10	UTSW	5	121626205	missense	possibly damaging	0.82
R9171:Acad10	UTSW	5	121629918	missense	probably benign	0.14
X0061:Acad10	UTSW	5	121622813	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- GAATGGGAGCATACTTGAGGTC -3'
(R):5'- TTTCCCGGGAGTACACACAG -3'

Sequencing Primer
(F):5'- TCAGCAGTTCAAGGGCAC -3'
(R):5'- AGGACTTGTGGCCGTCACTC -3'

Posted On

2018-05-04