Incidental Mutation 'R6384:Acad10'
ID515497
Institutional Source Beutler Lab
Gene Symbol Acad10
Ensembl Gene ENSMUSG00000029456
Gene Nameacyl-Coenzyme A dehydrogenase family, member 10
Synonyms2410021P16Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6384 (G1)
Quality Score225.009
Status Not validated
Chromosome5
Chromosomal Location121621026-121660514 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 121652003 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Serine at position 97 (T97S)
Ref Sequence ENSEMBL: ENSMUSP00000107400 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031412] [ENSMUST00000111770]
Predicted Effect probably benign
Transcript: ENSMUST00000031412
AA Change: T97S

PolyPhen 2 Score 0.426 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000031412
Gene: ENSMUSG00000029456
AA Change: T97S

DomainStartEndE-ValueType
Pfam:HAD_2 45 231 1.6e-14 PFAM
Pfam:Hydrolase 88 225 5e-8 PFAM
Pfam:APH 287 531 1.8e-52 PFAM
Pfam:Acyl-CoA_dh_N 660 787 1.7e-15 PFAM
Pfam:Acyl-CoA_dh_M 791 892 2.7e-20 PFAM
Pfam:Acyl-CoA_dh_1 904 1055 1.1e-35 PFAM
Pfam:Acyl-CoA_dh_2 919 1037 6.4e-13 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000111770
AA Change: T97S

PolyPhen 2 Score 0.426 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000107400
Gene: ENSMUSG00000029456
AA Change: T97S

DomainStartEndE-ValueType
Pfam:HAD_2 45 231 2.3e-14 PFAM
Pfam:APH 287 523 3.2e-50 PFAM
Pfam:EcKinase 390 504 5.2e-8 PFAM
Pfam:Acyl-CoA_dh_N 660 787 3.4e-14 PFAM
Pfam:Acyl-CoA_dh_M 791 845 2.7e-13 PFAM
Pfam:Acyl-CoA_dh_1 904 1055 9.4e-36 PFAM
Pfam:Acyl-CoA_dh_2 919 1037 1.6e-14 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133775
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 98.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the acyl-CoA dehydrogenase family of enzymes (ACADs), which participate in the beta-oxidation of fatty acids in mitochondria. The encoded enzyme contains a hydrolase domain at the N-terminal portion, a serine/threonine protein kinase catlytic domain in the central region, and a conserved ACAD domain at the C-terminus. Several alternatively spliced transcript variants of this gene have been described, but the full-length nature of some of these variants has not been determined. [provided by RefSeq, Nov 2008]
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam34 T A 8: 43,650,799 D603V probably benign Het
Adamts5 C T 16: 85,862,828 V859I probably benign Het
Alb T A 5: 90,472,640 D536E possibly damaging Het
Amz2 A G 11: 109,429,034 Y82C probably damaging Het
Asxl1 T C 2: 153,391,824 probably null Het
Bach1 C T 16: 87,719,857 Q429* probably null Het
Bcl6 A G 16: 23,974,865 Y111H probably damaging Het
Ccnj T C 19: 40,846,007 V338A probably benign Het
Cdca3 C T 6: 124,832,419 P174L probably damaging Het
Cdk17 T C 10: 93,211,965 L25P probably damaging Het
Cdr2 G A 7: 120,982,128 probably null Het
Cyp2c38 A T 19: 39,392,293 probably null Het
Ednra T C 8: 77,689,094 N175D probably damaging Het
Elp3 T C 14: 65,560,211 Y337C probably damaging Het
Eml2 G A 7: 19,201,163 V432I probably damaging Het
Eps15l1 A T 8: 72,368,710 probably null Het
F11r A G 1: 171,460,940 N117S probably benign Het
Foxp2 C T 6: 15,437,948 T716I probably damaging Het
Gnaq A G 19: 16,316,013 probably null Het
Gpat2 G C 2: 127,431,918 G294R possibly damaging Het
Gpr158 T C 2: 21,826,288 M733T probably damaging Het
Hdac7 G A 15: 97,811,506 Q48* probably null Het
Hmga2 G A 10: 120,370,707 probably benign Het
Itgb7 A G 15: 102,224,451 V142A probably benign Het
Kif5a T C 10: 127,242,775 N334D probably damaging Het
Lrrc47 T C 4: 154,015,860 S298P probably benign Het
Map3k1 A T 13: 111,750,530 S1415R probably damaging Het
Mdn1 T A 4: 32,670,607 L424Q probably damaging Het
Numb A C 12: 83,803,974 L154R probably damaging Het
Olfr1076 A G 2: 86,509,037 K193E probably benign Het
Olfr944 T C 9: 39,217,978 V207A probably benign Het
Pdcd5 G T 7: 35,646,909 A92E possibly damaging Het
Pdcl2 C T 5: 76,331,008 probably null Het
Rbfa T C 18: 80,192,781 Y251C probably damaging Het
Rgsl1 G A 1: 153,827,545 T120I possibly damaging Het
Serpina3g A G 12: 104,240,396 Q152R probably null Het
Setx T C 2: 29,173,558 S2289P probably damaging Het
Slc6a16 A G 7: 45,257,593 probably null Het
Slco1a6 C T 6: 142,109,379 D280N probably benign Het
Syde2 T A 3: 145,998,813 Y240N probably damaging Het
Synpo2 G A 3: 123,113,049 Q873* probably null Het
Tlr2 A G 3: 83,836,994 V594A probably benign Het
Ttc16 C T 2: 32,767,549 A512T probably damaging Het
Tubb5 T C 17: 35,838,046 E3G probably damaging Het
Vmn2r112 T C 17: 22,605,155 Y464H probably damaging Het
Xcr1 T A 9: 123,855,782 H305L probably damaging Het
Yars T G 4: 129,196,978 probably null Het
Other mutations in Acad10
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02379:Acad10 APN 5 121622043 missense probably damaging 1.00
IGL02469:Acad10 APN 5 121645459 missense probably damaging 1.00
IGL02526:Acad10 APN 5 121646860 missense probably damaging 0.99
IGL02623:Acad10 APN 5 121629930 missense possibly damaging 0.94
IGL02643:Acad10 APN 5 121631570 missense probably benign
IGL02685:Acad10 APN 5 121632609 missense probably benign
IGL03139:Acad10 APN 5 121626082 missense probably benign
IGL03267:Acad10 APN 5 121637349 missense probably benign 0.34
P0026:Acad10 UTSW 5 121637352 missense probably damaging 1.00
R0099:Acad10 UTSW 5 121621290 missense probably damaging 1.00
R0453:Acad10 UTSW 5 121627382 nonsense probably null
R1051:Acad10 UTSW 5 121626080 missense probably damaging 0.97
R1052:Acad10 UTSW 5 121649541 missense possibly damaging 0.65
R1116:Acad10 UTSW 5 121630751 missense probably damaging 1.00
R1548:Acad10 UTSW 5 121626040 splice site probably benign
R1548:Acad10 UTSW 5 121626041 splice site probably benign
R1571:Acad10 UTSW 5 121621348 missense probably damaging 0.99
R1592:Acad10 UTSW 5 121645381 missense probably damaging 0.99
R1741:Acad10 UTSW 5 121647836 missense probably damaging 1.00
R1789:Acad10 UTSW 5 121631393 missense possibly damaging 0.67
R1974:Acad10 UTSW 5 121626185 missense possibly damaging 0.95
R2007:Acad10 UTSW 5 121634751 missense probably damaging 1.00
R2085:Acad10 UTSW 5 121649460 missense possibly damaging 0.79
R2351:Acad10 UTSW 5 121629927 missense probably benign 0.23
R2511:Acad10 UTSW 5 121631567 missense probably benign 0.02
R2570:Acad10 UTSW 5 121630204 missense probably damaging 1.00
R3824:Acad10 UTSW 5 121622818 missense probably benign
R3846:Acad10 UTSW 5 121634686 missense probably benign 0.19
R4106:Acad10 UTSW 5 121631464 missense probably damaging 0.98
R4107:Acad10 UTSW 5 121631464 missense probably damaging 0.98
R4108:Acad10 UTSW 5 121631464 missense probably damaging 0.98
R5569:Acad10 UTSW 5 121626080 missense probably damaging 0.97
R5704:Acad10 UTSW 5 121631543 missense probably benign 0.03
R5845:Acad10 UTSW 5 121626083 missense probably benign
R5990:Acad10 UTSW 5 121645405 missense probably damaging 1.00
R6019:Acad10 UTSW 5 121634801 missense possibly damaging 0.88
R6145:Acad10 UTSW 5 121622033 missense probably damaging 0.97
R6491:Acad10 UTSW 5 121630157 missense probably damaging 1.00
R6608:Acad10 UTSW 5 121632492 missense probably benign 0.02
R6941:Acad10 UTSW 5 121649357 missense probably damaging 1.00
R7221:Acad10 UTSW 5 121630210 missense probably damaging 1.00
R7283:Acad10 UTSW 5 121649475 missense possibly damaging 0.79
R7355:Acad10 UTSW 5 121630717 nonsense probably null
R7483:Acad10 UTSW 5 121656012 critical splice donor site probably null
R7553:Acad10 UTSW 5 121639255 missense probably damaging 1.00
R7721:Acad10 UTSW 5 121646866 splice site probably null
R8075:Acad10 UTSW 5 121652085 missense probably benign 0.00
X0061:Acad10 UTSW 5 121622813 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GAATGGGAGCATACTTGAGGTC -3'
(R):5'- TTTCCCGGGAGTACACACAG -3'

Sequencing Primer
(F):5'- TCAGCAGTTCAAGGGCAC -3'
(R):5'- AGGACTTGTGGCCGTCACTC -3'
Posted On2018-05-04