Incidental Mutation 'R6384:Foxp2'
ID515498
Institutional Source Beutler Lab
Gene Symbol Foxp2
Ensembl Gene ENSMUSG00000029563
Gene Nameforkhead box P2
SynonymsD0Kist7, 2810043D05Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6384 (G1)
Quality Score225.009
Status Not validated
Chromosome6
Chromosomal Location14901349-15441977 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 15437948 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Isoleucine at position 716 (T716I)
Ref Sequence ENSEMBL: ENSMUSP00000111134 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031545] [ENSMUST00000115472] [ENSMUST00000115474] [ENSMUST00000115475] [ENSMUST00000115477]
Predicted Effect unknown
Transcript: ENSMUST00000031545
AA Change: T691I
SMART Domains Protein: ENSMUSP00000031545
Gene: ENSMUSG00000029563
AA Change: T691I

DomainStartEndE-ValueType
low complexity region 30 42 N/A INTRINSIC
low complexity region 49 69 N/A INTRINSIC
coiled coil region 140 215 N/A INTRINSIC
low complexity region 291 304 N/A INTRINSIC
ZnF_C2H2 345 370 3.02e0 SMART
low complexity region 437 458 N/A INTRINSIC
FH 501 582 7.5e-37 SMART
low complexity region 605 624 N/A INTRINSIC
low complexity region 697 714 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000115472
AA Change: T670I
SMART Domains Protein: ENSMUSP00000111132
Gene: ENSMUSG00000029563
AA Change: T670I

DomainStartEndE-ValueType
low complexity region 30 42 N/A INTRINSIC
low complexity region 49 69 N/A INTRINSIC
coiled coil region 116 194 N/A INTRINSIC
low complexity region 270 283 N/A INTRINSIC
ZnF_C2H2 324 349 3.02e0 SMART
low complexity region 416 437 N/A INTRINSIC
FH 480 561 7.5e-37 SMART
low complexity region 584 603 N/A INTRINSIC
low complexity region 676 693 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000115474
AA Change: T716I

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000111134
Gene: ENSMUSG00000029563
AA Change: T716I

DomainStartEndE-ValueType
low complexity region 30 42 N/A INTRINSIC
low complexity region 49 69 N/A INTRINSIC
coiled coil region 165 240 N/A INTRINSIC
low complexity region 316 329 N/A INTRINSIC
ZnF_C2H2 370 395 3.02e0 SMART
low complexity region 462 483 N/A INTRINSIC
FH 526 607 7.5e-37 SMART
low complexity region 630 649 N/A INTRINSIC
low complexity region 722 739 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000115475
SMART Domains Protein: ENSMUSP00000111135
Gene: ENSMUSG00000029563

DomainStartEndE-ValueType
low complexity region 8 46 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000115477
AA Change: T691I
SMART Domains Protein: ENSMUSP00000111137
Gene: ENSMUSG00000029563
AA Change: T691I

DomainStartEndE-ValueType
low complexity region 30 42 N/A INTRINSIC
low complexity region 49 69 N/A INTRINSIC
coiled coil region 140 215 N/A INTRINSIC
low complexity region 291 304 N/A INTRINSIC
ZnF_C2H2 345 370 3.02e0 SMART
low complexity region 437 458 N/A INTRINSIC
FH 501 582 7.5e-37 SMART
low complexity region 605 624 N/A INTRINSIC
low complexity region 697 714 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 98.2%
Validation Efficiency
MGI Phenotype PHENOTYPE: Homozygous null mice display postnatal lethality, growth retardation, reduced vocalization, prolonged external granule cell layer presence, abnormal Purkinje and radial glial cells, delayed eye opening and ear emergence, negative geotaxis, impaired righting response, and hypoactivity. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acad10 T A 5: 121,652,003 T97S probably benign Het
Adam34 T A 8: 43,650,799 D603V probably benign Het
Adamts5 C T 16: 85,862,828 V859I probably benign Het
Alb T A 5: 90,472,640 D536E possibly damaging Het
Amz2 A G 11: 109,429,034 Y82C probably damaging Het
Asxl1 T C 2: 153,391,824 probably null Het
Bach1 C T 16: 87,719,857 Q429* probably null Het
Bcl6 A G 16: 23,974,865 Y111H probably damaging Het
Ccnj T C 19: 40,846,007 V338A probably benign Het
Cdca3 C T 6: 124,832,419 P174L probably damaging Het
Cdk17 T C 10: 93,211,965 L25P probably damaging Het
Cdr2 G A 7: 120,982,128 probably null Het
Cyp2c38 A T 19: 39,392,293 probably null Het
Ednra T C 8: 77,689,094 N175D probably damaging Het
Elp3 T C 14: 65,560,211 Y337C probably damaging Het
Eml2 G A 7: 19,201,163 V432I probably damaging Het
Eps15l1 A T 8: 72,368,710 probably null Het
F11r A G 1: 171,460,940 N117S probably benign Het
Gnaq A G 19: 16,316,013 probably null Het
Gpat2 G C 2: 127,431,918 G294R possibly damaging Het
Gpr158 T C 2: 21,826,288 M733T probably damaging Het
Hdac7 G A 15: 97,811,506 Q48* probably null Het
Hmga2 G A 10: 120,370,707 probably benign Het
Itgb7 A G 15: 102,224,451 V142A probably benign Het
Kif5a T C 10: 127,242,775 N334D probably damaging Het
Lrrc47 T C 4: 154,015,860 S298P probably benign Het
Map3k1 A T 13: 111,750,530 S1415R probably damaging Het
Mdn1 T A 4: 32,670,607 L424Q probably damaging Het
Numb A C 12: 83,803,974 L154R probably damaging Het
Olfr1076 A G 2: 86,509,037 K193E probably benign Het
Olfr944 T C 9: 39,217,978 V207A probably benign Het
Pdcd5 G T 7: 35,646,909 A92E possibly damaging Het
Pdcl2 C T 5: 76,331,008 probably null Het
Rbfa T C 18: 80,192,781 Y251C probably damaging Het
Rgsl1 G A 1: 153,827,545 T120I possibly damaging Het
Serpina3g A G 12: 104,240,396 Q152R probably null Het
Setx T C 2: 29,173,558 S2289P probably damaging Het
Slc6a16 A G 7: 45,257,593 probably null Het
Slco1a6 C T 6: 142,109,379 D280N probably benign Het
Syde2 T A 3: 145,998,813 Y240N probably damaging Het
Synpo2 G A 3: 123,113,049 Q873* probably null Het
Tlr2 A G 3: 83,836,994 V594A probably benign Het
Ttc16 C T 2: 32,767,549 A512T probably damaging Het
Tubb5 T C 17: 35,838,046 E3G probably damaging Het
Vmn2r112 T C 17: 22,605,155 Y464H probably damaging Het
Xcr1 T A 9: 123,855,782 H305L probably damaging Het
Yars T G 4: 129,196,978 probably null Het
Other mutations in Foxp2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00515:Foxp2 APN 6 15403819 missense probably damaging 1.00
IGL01011:Foxp2 APN 6 15438019 makesense probably null
IGL01412:Foxp2 APN 6 15376758 intron probably benign
IGL01769:Foxp2 APN 6 15409835 missense possibly damaging 0.92
IGL02578:Foxp2 APN 6 15376815 intron probably benign
IGL03368:Foxp2 APN 6 15394718 missense probably damaging 1.00
R0004:Foxp2 UTSW 6 15197096 missense possibly damaging 0.68
R0081:Foxp2 UTSW 6 15405644 critical splice donor site probably benign
R0095:Foxp2 UTSW 6 15196977 missense probably damaging 1.00
R0233:Foxp2 UTSW 6 15409753 missense probably damaging 1.00
R0294:Foxp2 UTSW 6 15376774 intron probably benign
R0357:Foxp2 UTSW 6 15409840 missense probably damaging 0.99
R0432:Foxp2 UTSW 6 15254279 intron probably benign
R0659:Foxp2 UTSW 6 15254279 intron probably benign
R1381:Foxp2 UTSW 6 15409766 missense possibly damaging 0.50
R1813:Foxp2 UTSW 6 15379768 utr 3 prime probably benign
R1896:Foxp2 UTSW 6 15379768 utr 3 prime probably benign
R2007:Foxp2 UTSW 6 15396819 missense probably damaging 1.00
R2020:Foxp2 UTSW 6 15324644 missense possibly damaging 0.73
R2167:Foxp2 UTSW 6 15437902 missense probably damaging 1.00
R2326:Foxp2 UTSW 6 15409939 missense possibly damaging 0.84
R3829:Foxp2 UTSW 6 15379831 unclassified probably benign
R3978:Foxp2 UTSW 6 15197208 unclassified probably benign
R4393:Foxp2 UTSW 6 15377690 intron probably benign
R4703:Foxp2 UTSW 6 15411248 missense probably benign 0.03
R5202:Foxp2 UTSW 6 15394771 missense probably benign 0.05
R5303:Foxp2 UTSW 6 15324637 missense probably benign 0.00
R5368:Foxp2 UTSW 6 15377914 intron probably benign
R5533:Foxp2 UTSW 6 15197120 nonsense probably null
R5655:Foxp2 UTSW 6 15197113 missense probably damaging 0.99
R6220:Foxp2 UTSW 6 15437948 missense probably damaging 1.00
R6241:Foxp2 UTSW 6 15394762 missense probably damaging 1.00
R6365:Foxp2 UTSW 6 15286685 missense probably damaging 1.00
R7217:Foxp2 UTSW 6 15416024 missense unknown
R7553:Foxp2 UTSW 6 15437882 missense unknown
R7881:Foxp2 UTSW 6 15409889 missense unknown
X0023:Foxp2 UTSW 6 15409835 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CCCTCAGATGCAGTTTAGGAAG -3'
(R):5'- AGGGCTGTCTCCTTTATCCATG -3'

Sequencing Primer
(F):5'- AAGACACAGGGTGGTCTTCC -3'
(R):5'- CACTGAGGTGTCACAAGT -3'
Posted On2018-05-04