Incidental Mutation 'R6384:Slc6a16'
ID515503
Institutional Source Beutler Lab
Gene Symbol Slc6a16
Ensembl Gene ENSMUSG00000094152
Gene Namesolute carrier family 6, member 16
SynonymsLOC381884
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.099) question?
Stock #R6384 (G1)
Quality Score161.009
Status Not validated
Chromosome7
Chromosomal Location45241085-45273367 bp(+) (GRCm38)
Type of Mutationintron (57 bp from exon)
DNA Base Change (assembly) A to G at 45257593 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000149306 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000179310] [ENSMUST00000213347]
Predicted Effect noncoding transcript
Transcript: ENSMUST00000157656
Predicted Effect probably benign
Transcript: ENSMUST00000179310
SMART Domains Protein: ENSMUSP00000136199
Gene: ENSMUSG00000094152

DomainStartEndE-ValueType
Pfam:SNF 114 668 2.4e-100 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000179310
Predicted Effect probably null
Transcript: ENSMUST00000213347
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 98.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] SLC6A16 shows structural characteristics of an Na(+)- and Cl(-)-dependent neurotransmitter transporter, including 12 transmembrane (TM) domains, intracellular N and C termini, and large extracellular loops containing multiple N-glycosylation sites.[supplied by OMIM, Mar 2008]
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acad10 T A 5: 121,652,003 T97S probably benign Het
Adam34 T A 8: 43,650,799 D603V probably benign Het
Adamts5 C T 16: 85,862,828 V859I probably benign Het
Alb T A 5: 90,472,640 D536E possibly damaging Het
Amz2 A G 11: 109,429,034 Y82C probably damaging Het
Asxl1 T C 2: 153,391,824 probably null Het
Bach1 C T 16: 87,719,857 Q429* probably null Het
Bcl6 A G 16: 23,974,865 Y111H probably damaging Het
Ccnj T C 19: 40,846,007 V338A probably benign Het
Cdca3 C T 6: 124,832,419 P174L probably damaging Het
Cdk17 T C 10: 93,211,965 L25P probably damaging Het
Cdr2 G A 7: 120,982,128 probably null Het
Cyp2c38 A T 19: 39,392,293 probably null Het
Ednra T C 8: 77,689,094 N175D probably damaging Het
Elp3 T C 14: 65,560,211 Y337C probably damaging Het
Eml2 G A 7: 19,201,163 V432I probably damaging Het
Eps15l1 A T 8: 72,368,710 probably null Het
F11r A G 1: 171,460,940 N117S probably benign Het
Foxp2 C T 6: 15,437,948 T716I probably damaging Het
Gnaq A G 19: 16,316,013 probably null Het
Gpat2 G C 2: 127,431,918 G294R possibly damaging Het
Gpr158 T C 2: 21,826,288 M733T probably damaging Het
Hdac7 G A 15: 97,811,506 Q48* probably null Het
Hmga2 G A 10: 120,370,707 probably benign Het
Itgb7 A G 15: 102,224,451 V142A probably benign Het
Kif5a T C 10: 127,242,775 N334D probably damaging Het
Lrrc47 T C 4: 154,015,860 S298P probably benign Het
Map3k1 A T 13: 111,750,530 S1415R probably damaging Het
Mdn1 T A 4: 32,670,607 L424Q probably damaging Het
Numb A C 12: 83,803,974 L154R probably damaging Het
Olfr1076 A G 2: 86,509,037 K193E probably benign Het
Olfr944 T C 9: 39,217,978 V207A probably benign Het
Pdcd5 G T 7: 35,646,909 A92E possibly damaging Het
Pdcl2 C T 5: 76,331,008 probably null Het
Rbfa T C 18: 80,192,781 Y251C probably damaging Het
Rgsl1 G A 1: 153,827,545 T120I possibly damaging Het
Serpina3g A G 12: 104,240,396 Q152R probably null Het
Setx T C 2: 29,173,558 S2289P probably damaging Het
Slco1a6 C T 6: 142,109,379 D280N probably benign Het
Syde2 T A 3: 145,998,813 Y240N probably damaging Het
Synpo2 G A 3: 123,113,049 Q873* probably null Het
Tlr2 A G 3: 83,836,994 V594A probably benign Het
Ttc16 C T 2: 32,767,549 A512T probably damaging Het
Tubb5 T C 17: 35,838,046 E3G probably damaging Het
Vmn2r112 T C 17: 22,605,155 Y464H probably damaging Het
Xcr1 T A 9: 123,855,782 H305L probably damaging Het
Yars T G 4: 129,196,978 probably null Het
Other mutations in Slc6a16
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0345:Slc6a16 UTSW 7 45259248 missense possibly damaging 0.50
R1721:Slc6a16 UTSW 7 45261176 missense possibly damaging 0.86
R3788:Slc6a16 UTSW 7 45259962 missense probably benign 0.01
R3854:Slc6a16 UTSW 7 45268172 missense probably damaging 1.00
R5024:Slc6a16 UTSW 7 45259966 missense probably benign 0.02
R5450:Slc6a16 UTSW 7 45261248 missense probably benign 0.33
R5624:Slc6a16 UTSW 7 45261108 missense probably benign 0.00
R5756:Slc6a16 UTSW 7 45260850 missense possibly damaging 0.95
R6224:Slc6a16 UTSW 7 45261148 missense probably damaging 1.00
R6736:Slc6a16 UTSW 7 45259028 missense possibly damaging 0.57
R7035:Slc6a16 UTSW 7 45260827 missense probably damaging 1.00
R7525:Slc6a16 UTSW 7 45259113 missense probably benign 0.01
R7527:Slc6a16 UTSW 7 45272639 missense probably damaging 1.00
R7681:Slc6a16 UTSW 7 45260914 missense probably damaging 1.00
R7884:Slc6a16 UTSW 7 45259347 missense probably damaging 0.99
R7967:Slc6a16 UTSW 7 45259347 missense probably damaging 0.99
Z1177:Slc6a16 UTSW 7 45260908 missense probably damaging 0.97
Predicted Primers PCR Primer
(F):5'- AGTCATTCCTGTCGCAGTCTG -3'
(R):5'- TCACAGACAGGTTTGGGAAC -3'

Sequencing Primer
(F):5'- ATTCCTGTCGCAGTCTGTCATC -3'
(R):5'- GGAACCCTGCTTTGCCTCAC -3'
Posted On2018-05-04