Incidental Mutation 'R6384:Ednra'
ID515507
Institutional Source Beutler Lab
Gene Symbol Ednra
Ensembl Gene ENSMUSG00000031616
Gene Nameendothelin receptor type A
SynonymsGpcr10, ET-AR, ETa
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6384 (G1)
Quality Score225.009
Status Not validated
Chromosome8
Chromosomal Location77663031-77724464 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 77689094 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Aspartic acid at position 175 (N175D)
Ref Sequence ENSEMBL: ENSMUSP00000034029 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034029]
Predicted Effect probably damaging
Transcript: ENSMUST00000034029
AA Change: N175D

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000034029
Gene: ENSMUSG00000031616
AA Change: N175D

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
Pfam:7tm_1 97 370 8.4e-36 PFAM
low complexity region 376 394 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139140
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146561
Predicted Effect noncoding transcript
Transcript: ENSMUST00000153937
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 98.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes the receptor for endothelin-1, a peptide that plays a role in potent and long-lasting vasoconstriction. This receptor associates with guanine-nucleotide-binding (G) proteins, and this coupling activates a phosphatidylinositol-calcium second messenger system. Polymorphisms in this gene have been linked to migraine headache resistance. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Oct 2009]
PHENOTYPE: Homozygous inactivation of this gene results in numerous severe craniofacial defects and perinatal lethality. Aberrant middle ear development and cardiac defects, including great vessel malformations and abnormal cardiac outflow tract development, have been observed. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acad10 T A 5: 121,652,003 T97S probably benign Het
Adam34 T A 8: 43,650,799 D603V probably benign Het
Adamts5 C T 16: 85,862,828 V859I probably benign Het
Alb T A 5: 90,472,640 D536E possibly damaging Het
Amz2 A G 11: 109,429,034 Y82C probably damaging Het
Asxl1 T C 2: 153,391,824 probably null Het
Bach1 C T 16: 87,719,857 Q429* probably null Het
Bcl6 A G 16: 23,974,865 Y111H probably damaging Het
Ccnj T C 19: 40,846,007 V338A probably benign Het
Cdca3 C T 6: 124,832,419 P174L probably damaging Het
Cdk17 T C 10: 93,211,965 L25P probably damaging Het
Cdr2 G A 7: 120,982,128 probably null Het
Cyp2c38 A T 19: 39,392,293 probably null Het
Elp3 T C 14: 65,560,211 Y337C probably damaging Het
Eml2 G A 7: 19,201,163 V432I probably damaging Het
Eps15l1 A T 8: 72,368,710 probably null Het
F11r A G 1: 171,460,940 N117S probably benign Het
Foxp2 C T 6: 15,437,948 T716I probably damaging Het
Gnaq A G 19: 16,316,013 probably null Het
Gpat2 G C 2: 127,431,918 G294R possibly damaging Het
Gpr158 T C 2: 21,826,288 M733T probably damaging Het
Hdac7 G A 15: 97,811,506 Q48* probably null Het
Hmga2 G A 10: 120,370,707 probably benign Het
Itgb7 A G 15: 102,224,451 V142A probably benign Het
Kif5a T C 10: 127,242,775 N334D probably damaging Het
Lrrc47 T C 4: 154,015,860 S298P probably benign Het
Map3k1 A T 13: 111,750,530 S1415R probably damaging Het
Mdn1 T A 4: 32,670,607 L424Q probably damaging Het
Numb A C 12: 83,803,974 L154R probably damaging Het
Olfr1076 A G 2: 86,509,037 K193E probably benign Het
Olfr944 T C 9: 39,217,978 V207A probably benign Het
Pdcd5 G T 7: 35,646,909 A92E possibly damaging Het
Pdcl2 C T 5: 76,331,008 probably null Het
Rbfa T C 18: 80,192,781 Y251C probably damaging Het
Rgsl1 G A 1: 153,827,545 T120I possibly damaging Het
Serpina3g A G 12: 104,240,396 Q152R probably null Het
Setx T C 2: 29,173,558 S2289P probably damaging Het
Slc6a16 A G 7: 45,257,593 probably null Het
Slco1a6 C T 6: 142,109,379 D280N probably benign Het
Syde2 T A 3: 145,998,813 Y240N probably damaging Het
Synpo2 G A 3: 123,113,049 Q873* probably null Het
Tlr2 A G 3: 83,836,994 V594A probably benign Het
Ttc16 C T 2: 32,767,549 A512T probably damaging Het
Tubb5 T C 17: 35,838,046 E3G probably damaging Het
Vmn2r112 T C 17: 22,605,155 Y464H probably damaging Het
Xcr1 T A 9: 123,855,782 H305L probably damaging Het
Yars T G 4: 129,196,978 probably null Het
Other mutations in Ednra
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00899:Ednra APN 8 77675071 missense probably damaging 1.00
IGL02943:Ednra APN 8 77720054 missense probably damaging 1.00
IGL03213:Ednra APN 8 77720219 missense probably benign
Starved UTSW 8 77675067 missense possibly damaging 0.82
R0058:Ednra UTSW 8 77667322 critical splice donor site probably null
R0080:Ednra UTSW 8 77675059 missense probably benign
R0894:Ednra UTSW 8 77720020 splice site probably benign
R1746:Ednra UTSW 8 77671582 missense probably benign 0.44
R1872:Ednra UTSW 8 77720396 missense possibly damaging 0.46
R1934:Ednra UTSW 8 77689118 missense possibly damaging 0.55
R3776:Ednra UTSW 8 77675095 missense probably damaging 1.00
R4177:Ednra UTSW 8 77675048 missense possibly damaging 0.54
R4274:Ednra UTSW 8 77720302 missense probably benign 0.01
R4544:Ednra UTSW 8 77674911 critical splice donor site probably null
R4697:Ednra UTSW 8 77664995 missense probably benign 0.01
R4704:Ednra UTSW 8 77667963 intron probably benign
R4863:Ednra UTSW 8 77667383 missense probably damaging 1.00
R5265:Ednra UTSW 8 77667375 missense probably damaging 1.00
R5346:Ednra UTSW 8 77674968 missense probably damaging 1.00
R5772:Ednra UTSW 8 77675067 missense possibly damaging 0.82
R6005:Ednra UTSW 8 77674927 missense possibly damaging 0.91
R6147:Ednra UTSW 8 77667322 critical splice donor site probably benign
R6743:Ednra UTSW 8 77675089 missense probably damaging 0.99
R7084:Ednra UTSW 8 77665105 nonsense probably null
Predicted Primers PCR Primer
(F):5'- GGAAACCAGCTGTGTATCACTG -3'
(R):5'- TGGTCATGCATTCACACTGGG -3'

Sequencing Primer
(F):5'- TGCATACCGTGAAGAGTCTC -3'
(R):5'- GCATTCACACTGGGTATATGAGC -3'
Posted On2018-05-04