Incidental Mutation 'R6384:Olfr944'
ID515508
Institutional Source Beutler Lab
Gene Symbol Olfr944
Ensembl Gene ENSMUSG00000096555
Gene Nameolfactory receptor 944
SynonymsGA_x6K02T2PVTD-32914568-32915503, MOR171-19
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.057) question?
Stock #R6384 (G1)
Quality Score225.009
Status Not validated
Chromosome9
Chromosomal Location39201920-39218421 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 39217978 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 207 (V207A)
Ref Sequence ENSEMBL: ENSMUSP00000150471 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000079650] [ENSMUST00000213908] [ENSMUST00000215306]
Predicted Effect probably benign
Transcript: ENSMUST00000079650
AA Change: V207A

PolyPhen 2 Score 0.057 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000078595
Gene: ENSMUSG00000096555
AA Change: V207A

DomainStartEndE-ValueType
Pfam:7tm_4 31 308 2.5e-47 PFAM
Pfam:7tm_1 41 290 2.1e-19 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000213908
AA Change: V207A

PolyPhen 2 Score 0.057 (Sensitivity: 0.94; Specificity: 0.84)
Predicted Effect probably benign
Transcript: ENSMUST00000215306
AA Change: V207A

PolyPhen 2 Score 0.057 (Sensitivity: 0.94; Specificity: 0.84)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 98.2%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acad10 T A 5: 121,652,003 T97S probably benign Het
Adam34 T A 8: 43,650,799 D603V probably benign Het
Adamts5 C T 16: 85,862,828 V859I probably benign Het
Alb T A 5: 90,472,640 D536E possibly damaging Het
Amz2 A G 11: 109,429,034 Y82C probably damaging Het
Asxl1 T C 2: 153,391,824 probably null Het
Bach1 C T 16: 87,719,857 Q429* probably null Het
Bcl6 A G 16: 23,974,865 Y111H probably damaging Het
Ccnj T C 19: 40,846,007 V338A probably benign Het
Cdca3 C T 6: 124,832,419 P174L probably damaging Het
Cdk17 T C 10: 93,211,965 L25P probably damaging Het
Cdr2 G A 7: 120,982,128 probably null Het
Cyp2c38 A T 19: 39,392,293 probably null Het
Ednra T C 8: 77,689,094 N175D probably damaging Het
Elp3 T C 14: 65,560,211 Y337C probably damaging Het
Eml2 G A 7: 19,201,163 V432I probably damaging Het
Eps15l1 A T 8: 72,368,710 probably null Het
F11r A G 1: 171,460,940 N117S probably benign Het
Foxp2 C T 6: 15,437,948 T716I probably damaging Het
Gnaq A G 19: 16,316,013 probably null Het
Gpat2 G C 2: 127,431,918 G294R possibly damaging Het
Gpr158 T C 2: 21,826,288 M733T probably damaging Het
Hdac7 G A 15: 97,811,506 Q48* probably null Het
Hmga2 G A 10: 120,370,707 probably benign Het
Itgb7 A G 15: 102,224,451 V142A probably benign Het
Kif5a T C 10: 127,242,775 N334D probably damaging Het
Lrrc47 T C 4: 154,015,860 S298P probably benign Het
Map3k1 A T 13: 111,750,530 S1415R probably damaging Het
Mdn1 T A 4: 32,670,607 L424Q probably damaging Het
Numb A C 12: 83,803,974 L154R probably damaging Het
Olfr1076 A G 2: 86,509,037 K193E probably benign Het
Pdcd5 G T 7: 35,646,909 A92E possibly damaging Het
Pdcl2 C T 5: 76,331,008 probably null Het
Rbfa T C 18: 80,192,781 Y251C probably damaging Het
Rgsl1 G A 1: 153,827,545 T120I possibly damaging Het
Serpina3g A G 12: 104,240,396 Q152R probably null Het
Setx T C 2: 29,173,558 S2289P probably damaging Het
Slc6a16 A G 7: 45,257,593 probably null Het
Slco1a6 C T 6: 142,109,379 D280N probably benign Het
Syde2 T A 3: 145,998,813 Y240N probably damaging Het
Synpo2 G A 3: 123,113,049 Q873* probably null Het
Tlr2 A G 3: 83,836,994 V594A probably benign Het
Ttc16 C T 2: 32,767,549 A512T probably damaging Het
Tubb5 T C 17: 35,838,046 E3G probably damaging Het
Vmn2r112 T C 17: 22,605,155 Y464H probably damaging Het
Xcr1 T A 9: 123,855,782 H305L probably damaging Het
Yars T G 4: 129,196,978 probably null Het
Other mutations in Olfr944
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01096:Olfr944 APN 9 39218116 missense probably damaging 1.00
IGL01529:Olfr944 APN 9 39218131 missense probably benign 0.30
IGL03307:Olfr944 APN 9 39218013 missense probably benign 0.03
R0110:Olfr944 UTSW 9 39217728 missense possibly damaging 0.50
R0413:Olfr944 UTSW 9 39218270 missense probably benign 0.25
R0450:Olfr944 UTSW 9 39217728 missense possibly damaging 0.50
R2108:Olfr944 UTSW 9 39218022 missense probably damaging 0.99
R2112:Olfr944 UTSW 9 39217779 missense probably benign 0.01
R4666:Olfr944 UTSW 9 39217846 missense probably damaging 0.97
R5039:Olfr944 UTSW 9 39218114 nonsense probably null
R8124:Olfr944 UTSW 9 39217671 missense probably benign
Predicted Primers PCR Primer
(F):5'- TACAATTCTCTGATTTCGGGGTC -3'
(R):5'- AGGACACTTTTGCTTGGCCC -3'

Sequencing Primer
(F):5'- CTGATTTCGGGGTCATATATTTTTGC -3'
(R):5'- TGCTTGGCCCATAGAATTCAG -3'
Posted On2018-05-04