Incidental Mutation 'R6384:Xcr1'
ID515509
Institutional Source Beutler Lab
Gene Symbol Xcr1
Ensembl Gene ENSMUSG00000060509
Gene Namechemokine (C motif) receptor 1
SynonymsCcxcr1, XCR1, C motif-1/lymphotactin receptor, GPR5
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.103) question?
Stock #R6384 (G1)
Quality Score225.009
Status Not validated
Chromosome9
Chromosomal Location123852315-123862029 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 123855782 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Leucine at position 305 (H305L)
Ref Sequence ENSEMBL: ENSMUSP00000138255 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000084715] [ENSMUST00000167595] [ENSMUST00000182350] [ENSMUST00000184082]
Predicted Effect probably benign
Transcript: ENSMUST00000084715
SMART Domains Protein: ENSMUSP00000081764
Gene: ENSMUSG00000025241

DomainStartEndE-ValueType
Pfam:RUN 19 167 4.7e-12 PFAM
low complexity region 196 206 N/A INTRINSIC
coiled coil region 223 270 N/A INTRINSIC
coiled coil region 348 1110 N/A INTRINSIC
FYVE 1124 1191 2.69e-16 SMART
PDB:1OLM|E 1343 1428 1e-5 PDB
Predicted Effect probably benign
Transcript: ENSMUST00000167595
SMART Domains Protein: ENSMUSP00000133222
Gene: ENSMUSG00000025241

DomainStartEndE-ValueType
Pfam:RUN 20 167 7.8e-12 PFAM
low complexity region 196 206 N/A INTRINSIC
coiled coil region 223 270 N/A INTRINSIC
coiled coil region 348 1110 N/A INTRINSIC
FYVE 1124 1191 2.69e-16 SMART
PDB:1OLM|E 1343 1428 1e-5 PDB
Predicted Effect probably damaging
Transcript: ENSMUST00000182350
AA Change: H305L

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000138255
Gene: ENSMUSG00000060509
AA Change: H305L

DomainStartEndE-ValueType
low complexity region 48 59 N/A INTRINSIC
Pfam:7tm_1 60 295 1.9e-45 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000183700
Predicted Effect probably benign
Transcript: ENSMUST00000184082
SMART Domains Protein: ENSMUSP00000139343
Gene: ENSMUSG00000025241

DomainStartEndE-ValueType
Pfam:RUN 7 167 4.5e-12 PFAM
low complexity region 196 206 N/A INTRINSIC
coiled coil region 223 270 N/A INTRINSIC
low complexity region 355 366 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 98.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a chemokine receptor belonging to the G protein-coupled receptor superfamily. The family members are characterized by the presence of 7 transmembrane domains and numerous conserved amino acids. This receptor is most closely related to RBS11 and the MIP1-alpha/RANTES receptor. It transduces a signal by increasing the intracellular calcium ions level. The viral macrophage inflammatory protein-II is an antagonist of this receptor and blocks signaling. Two alternatively spliced transcript variants encoding the same protein have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a targeted null mutation exhibit reduced CD8+ dendritic cell migration in response to XCL1. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acad10 T A 5: 121,652,003 T97S probably benign Het
Adam34 T A 8: 43,650,799 D603V probably benign Het
Adamts5 C T 16: 85,862,828 V859I probably benign Het
Alb T A 5: 90,472,640 D536E possibly damaging Het
Amz2 A G 11: 109,429,034 Y82C probably damaging Het
Asxl1 T C 2: 153,391,824 probably null Het
Bach1 C T 16: 87,719,857 Q429* probably null Het
Bcl6 A G 16: 23,974,865 Y111H probably damaging Het
Ccnj T C 19: 40,846,007 V338A probably benign Het
Cdca3 C T 6: 124,832,419 P174L probably damaging Het
Cdk17 T C 10: 93,211,965 L25P probably damaging Het
Cdr2 G A 7: 120,982,128 probably null Het
Cyp2c38 A T 19: 39,392,293 probably null Het
Ednra T C 8: 77,689,094 N175D probably damaging Het
Elp3 T C 14: 65,560,211 Y337C probably damaging Het
Eml2 G A 7: 19,201,163 V432I probably damaging Het
Eps15l1 A T 8: 72,368,710 probably null Het
F11r A G 1: 171,460,940 N117S probably benign Het
Foxp2 C T 6: 15,437,948 T716I probably damaging Het
Gnaq A G 19: 16,316,013 probably null Het
Gpat2 G C 2: 127,431,918 G294R possibly damaging Het
Gpr158 T C 2: 21,826,288 M733T probably damaging Het
Hdac7 G A 15: 97,811,506 Q48* probably null Het
Hmga2 G A 10: 120,370,707 probably benign Het
Itgb7 A G 15: 102,224,451 V142A probably benign Het
Kif5a T C 10: 127,242,775 N334D probably damaging Het
Lrrc47 T C 4: 154,015,860 S298P probably benign Het
Map3k1 A T 13: 111,750,530 S1415R probably damaging Het
Mdn1 T A 4: 32,670,607 L424Q probably damaging Het
Numb A C 12: 83,803,974 L154R probably damaging Het
Olfr1076 A G 2: 86,509,037 K193E probably benign Het
Olfr944 T C 9: 39,217,978 V207A probably benign Het
Pdcd5 G T 7: 35,646,909 A92E possibly damaging Het
Pdcl2 C T 5: 76,331,008 probably null Het
Rbfa T C 18: 80,192,781 Y251C probably damaging Het
Rgsl1 G A 1: 153,827,545 T120I possibly damaging Het
Serpina3g A G 12: 104,240,396 Q152R probably null Het
Setx T C 2: 29,173,558 S2289P probably damaging Het
Slc6a16 A G 7: 45,257,593 probably null Het
Slco1a6 C T 6: 142,109,379 D280N probably benign Het
Syde2 T A 3: 145,998,813 Y240N probably damaging Het
Synpo2 G A 3: 123,113,049 Q873* probably null Het
Tlr2 A G 3: 83,836,994 V594A probably benign Het
Ttc16 C T 2: 32,767,549 A512T probably damaging Het
Tubb5 T C 17: 35,838,046 E3G probably damaging Het
Vmn2r112 T C 17: 22,605,155 Y464H probably damaging Het
Yars T G 4: 129,196,978 probably null Het
Other mutations in Xcr1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL03324:Xcr1 APN 9 123856484 missense probably benign 0.26
R0049:Xcr1 UTSW 9 123855875 missense possibly damaging 0.49
R0049:Xcr1 UTSW 9 123855875 missense possibly damaging 0.49
R0318:Xcr1 UTSW 9 123856154 missense possibly damaging 0.92
R0683:Xcr1 UTSW 9 123855875 missense probably benign 0.03
R4107:Xcr1 UTSW 9 123856088 missense possibly damaging 0.67
R4127:Xcr1 UTSW 9 123856496 missense probably damaging 1.00
R4859:Xcr1 UTSW 9 123856647 missense probably benign
R5408:Xcr1 UTSW 9 123856566 missense probably benign 0.00
R5419:Xcr1 UTSW 9 123856310 missense probably benign 0.06
R5817:Xcr1 UTSW 9 123855857 missense possibly damaging 0.94
R6051:Xcr1 UTSW 9 123856116 missense probably benign 0.01
R6395:Xcr1 UTSW 9 123855789 missense probably damaging 0.96
R6528:Xcr1 UTSW 9 123855983 missense probably damaging 1.00
R6594:Xcr1 UTSW 9 123856244 missense probably benign 0.00
R6990:Xcr1 UTSW 9 123856235 missense probably benign 0.15
R7648:Xcr1 UTSW 9 123856592 missense possibly damaging 0.54
Predicted Primers PCR Primer
(F):5'- GCCACTTCCCCATGGGTATC -3'
(R):5'- TCAGCTGGGCTCCCTACAAC -3'

Sequencing Primer
(F):5'- ATGGGTATCATGTCTTTCCTCCACAC -3'
(R):5'- CCTCACACTCTTCCTGAAAACTGG -3'
Posted On2018-05-04