Incidental Mutation 'R6384:Elp3'
ID515517
Institutional Source Beutler Lab
Gene Symbol Elp3
Ensembl Gene ENSMUSG00000022031
Gene Nameelongator acetyltransferase complex subunit 3
SynonymsKAT9, 2610507P14Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.955) question?
Stock #R6384 (G1)
Quality Score225.009
Status Not validated
Chromosome14
Chromosomal Location65530449-65593075 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 65560211 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Cysteine at position 337 (Y337C)
Ref Sequence ENSEMBL: ENSMUSP00000153462 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022609] [ENSMUST00000224743] [ENSMUST00000225355]
Predicted Effect probably damaging
Transcript: ENSMUST00000022609
AA Change: Y356C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000022609
Gene: ENSMUSG00000022031
AA Change: Y356C

DomainStartEndE-ValueType
Elp3 108 370 1.36e-37 SMART
Blast:Elp3 387 431 2e-19 BLAST
Pfam:Acetyltransf_1 460 555 1.1e-6 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000224743
AA Change: Y337C

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
Predicted Effect probably damaging
Transcript: ENSMUST00000225355
AA Change: Y337C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 98.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] ELP3 is the catalytic subunit of the histone acetyltransferase elongator complex, which contributes to transcript elongation and also regulates the maturation of projection neurons (Creppe et al., 2009 [PubMed 19185337]).[supplied by OMIM, Apr 2009]
PHENOTYPE: Embryos homozygous for a null gene trap mutation show severe growth retardation and die prior to E12.5. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acad10 T A 5: 121,652,003 T97S probably benign Het
Adam34 T A 8: 43,650,799 D603V probably benign Het
Adamts5 C T 16: 85,862,828 V859I probably benign Het
Alb T A 5: 90,472,640 D536E possibly damaging Het
Amz2 A G 11: 109,429,034 Y82C probably damaging Het
Asxl1 T C 2: 153,391,824 probably null Het
Bach1 C T 16: 87,719,857 Q429* probably null Het
Bcl6 A G 16: 23,974,865 Y111H probably damaging Het
Ccnj T C 19: 40,846,007 V338A probably benign Het
Cdca3 C T 6: 124,832,419 P174L probably damaging Het
Cdk17 T C 10: 93,211,965 L25P probably damaging Het
Cdr2 G A 7: 120,982,128 probably null Het
Cyp2c38 A T 19: 39,392,293 probably null Het
Ednra T C 8: 77,689,094 N175D probably damaging Het
Eml2 G A 7: 19,201,163 V432I probably damaging Het
Eps15l1 A T 8: 72,368,710 probably null Het
F11r A G 1: 171,460,940 N117S probably benign Het
Foxp2 C T 6: 15,437,948 T716I probably damaging Het
Gnaq A G 19: 16,316,013 probably null Het
Gpat2 G C 2: 127,431,918 G294R possibly damaging Het
Gpr158 T C 2: 21,826,288 M733T probably damaging Het
Hdac7 G A 15: 97,811,506 Q48* probably null Het
Hmga2 G A 10: 120,370,707 probably benign Het
Itgb7 A G 15: 102,224,451 V142A probably benign Het
Kif5a T C 10: 127,242,775 N334D probably damaging Het
Lrrc47 T C 4: 154,015,860 S298P probably benign Het
Map3k1 A T 13: 111,750,530 S1415R probably damaging Het
Mdn1 T A 4: 32,670,607 L424Q probably damaging Het
Numb A C 12: 83,803,974 L154R probably damaging Het
Olfr1076 A G 2: 86,509,037 K193E probably benign Het
Olfr944 T C 9: 39,217,978 V207A probably benign Het
Pdcd5 G T 7: 35,646,909 A92E possibly damaging Het
Pdcl2 C T 5: 76,331,008 probably null Het
Rbfa T C 18: 80,192,781 Y251C probably damaging Het
Rgsl1 G A 1: 153,827,545 T120I possibly damaging Het
Serpina3g A G 12: 104,240,396 Q152R probably null Het
Setx T C 2: 29,173,558 S2289P probably damaging Het
Slc6a16 A G 7: 45,257,593 probably null Het
Slco1a6 C T 6: 142,109,379 D280N probably benign Het
Syde2 T A 3: 145,998,813 Y240N probably damaging Het
Synpo2 G A 3: 123,113,049 Q873* probably null Het
Tlr2 A G 3: 83,836,994 V594A probably benign Het
Ttc16 C T 2: 32,767,549 A512T probably damaging Het
Tubb5 T C 17: 35,838,046 E3G probably damaging Het
Vmn2r112 T C 17: 22,605,155 Y464H probably damaging Het
Xcr1 T A 9: 123,855,782 H305L probably damaging Het
Yars T G 4: 129,196,978 probably null Het
Other mutations in Elp3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02477:Elp3 APN 14 65563311 missense probably benign
R0052:Elp3 UTSW 14 65531526 makesense probably null
R0333:Elp3 UTSW 14 65590593 missense probably benign 0.05
R0513:Elp3 UTSW 14 65563246 splice site probably null
R0980:Elp3 UTSW 14 65577953 missense probably damaging 1.00
R1137:Elp3 UTSW 14 65547921 missense probably damaging 0.99
R1259:Elp3 UTSW 14 65547939 missense probably damaging 0.96
R1378:Elp3 UTSW 14 65592931 missense probably benign
R1722:Elp3 UTSW 14 65551397 missense probably benign 0.02
R1789:Elp3 UTSW 14 65547919 missense probably damaging 1.00
R3843:Elp3 UTSW 14 65565483 splice site probably null
R4125:Elp3 UTSW 14 65560181 missense possibly damaging 0.64
R4196:Elp3 UTSW 14 65548002 missense probably damaging 1.00
R4400:Elp3 UTSW 14 65548090 missense possibly damaging 0.89
R4420:Elp3 UTSW 14 65580791 missense probably damaging 1.00
R4516:Elp3 UTSW 14 65547877 missense possibly damaging 0.46
R4764:Elp3 UTSW 14 65582929 missense probably damaging 1.00
R4838:Elp3 UTSW 14 65547864 critical splice donor site probably null
R5052:Elp3 UTSW 14 65577940 missense probably damaging 1.00
R5111:Elp3 UTSW 14 65560236 missense probably damaging 1.00
R5665:Elp3 UTSW 14 65551402 missense possibly damaging 0.80
R5702:Elp3 UTSW 14 65577982 missense probably damaging 1.00
R5754:Elp3 UTSW 14 65547990 missense probably damaging 1.00
R5927:Elp3 UTSW 14 65582177 missense probably damaging 1.00
R5999:Elp3 UTSW 14 65531540 missense probably benign 0.01
R6378:Elp3 UTSW 14 65592971 nonsense probably null
R6601:Elp3 UTSW 14 65547039 makesense probably null
R7263:Elp3 UTSW 14 65565333 missense probably damaging 0.98
R7857:Elp3 UTSW 14 65563310 missense probably benign 0.14
Predicted Primers PCR Primer
(F):5'- TCCTACACATGGCATTCCTG -3'
(R):5'- CCCCTGTACACTTGACAGAAGG -3'

Sequencing Primer
(F):5'- ACACATGGCATTCCTGATATTCTAC -3'
(R):5'- CCTGTACACTTGACAGAAGGGACAG -3'
Posted On2018-05-04