Incidental Mutation 'R6384:Hdac7'
ID515518
Institutional Source Beutler Lab
Gene Symbol Hdac7
Ensembl Gene ENSMUSG00000022475
Gene Namehistone deacetylase 7
SynonymsHdac7a, 5830434K02Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6384 (G1)
Quality Score213.009
Status Not validated
Chromosome15
Chromosomal Location97792664-97844502 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) G to A at 97811506 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Stop codon at position 48 (Q48*)
Ref Sequence ENSEMBL: ENSMUSP00000120576 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000079838] [ENSMUST00000088402] [ENSMUST00000116408] [ENSMUST00000116409] [ENSMUST00000118294] [ENSMUST00000119670] [ENSMUST00000120683] [ENSMUST00000121514] [ENSMUST00000156045]
Predicted Effect probably null
Transcript: ENSMUST00000079838
AA Change: Q48*
SMART Domains Protein: ENSMUSP00000078766
Gene: ENSMUSG00000022475
AA Change: Q48*

DomainStartEndE-ValueType
low complexity region 79 93 N/A INTRINSIC
low complexity region 97 113 N/A INTRINSIC
low complexity region 196 211 N/A INTRINSIC
low complexity region 357 375 N/A INTRINSIC
low complexity region 426 438 N/A INTRINSIC
low complexity region 442 454 N/A INTRINSIC
low complexity region 485 498 N/A INTRINSIC
Pfam:Hist_deacetyl 523 853 2.5e-91 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000088402
AA Change: Q48*
SMART Domains Protein: ENSMUSP00000085744
Gene: ENSMUSG00000022475
AA Change: Q48*

DomainStartEndE-ValueType
low complexity region 79 93 N/A INTRINSIC
low complexity region 97 113 N/A INTRINSIC
low complexity region 151 169 N/A INTRINSIC
low complexity region 220 235 N/A INTRINSIC
low complexity region 344 362 N/A INTRINSIC
low complexity region 420 432 N/A INTRINSIC
low complexity region 436 448 N/A INTRINSIC
low complexity region 479 492 N/A INTRINSIC
Pfam:Hist_deacetyl 517 847 2.5e-91 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000116408
AA Change: Q26*
SMART Domains Protein: ENSMUSP00000112109
Gene: ENSMUSG00000022475
AA Change: Q26*

DomainStartEndE-ValueType
low complexity region 57 71 N/A INTRINSIC
low complexity region 75 91 N/A INTRINSIC
low complexity region 129 147 N/A INTRINSIC
low complexity region 198 213 N/A INTRINSIC
low complexity region 322 340 N/A INTRINSIC
low complexity region 398 410 N/A INTRINSIC
low complexity region 414 426 N/A INTRINSIC
low complexity region 457 470 N/A INTRINSIC
Pfam:Hist_deacetyl 495 825 2.3e-91 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000116409
AA Change: Q26*
SMART Domains Protein: ENSMUSP00000112110
Gene: ENSMUSG00000022475
AA Change: Q26*

DomainStartEndE-ValueType
low complexity region 57 71 N/A INTRINSIC
low complexity region 75 91 N/A INTRINSIC
low complexity region 129 147 N/A INTRINSIC
low complexity region 198 213 N/A INTRINSIC
low complexity region 359 377 N/A INTRINSIC
low complexity region 435 447 N/A INTRINSIC
low complexity region 451 463 N/A INTRINSIC
low complexity region 494 507 N/A INTRINSIC
Pfam:Hist_deacetyl 532 862 9.1e-83 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000118294
AA Change: Q26*
SMART Domains Protein: ENSMUSP00000113380
Gene: ENSMUSG00000022475
AA Change: Q26*

DomainStartEndE-ValueType
low complexity region 57 71 N/A INTRINSIC
low complexity region 75 91 N/A INTRINSIC
low complexity region 129 147 N/A INTRINSIC
low complexity region 198 213 N/A INTRINSIC
low complexity region 359 377 N/A INTRINSIC
low complexity region 428 440 N/A INTRINSIC
low complexity region 444 456 N/A INTRINSIC
low complexity region 487 500 N/A INTRINSIC
Pfam:Hist_deacetyl 525 855 2.6e-91 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000119670
AA Change: Q26*
SMART Domains Protein: ENSMUSP00000112459
Gene: ENSMUSG00000022475
AA Change: Q26*

DomainStartEndE-ValueType
low complexity region 57 71 N/A INTRINSIC
low complexity region 75 91 N/A INTRINSIC
low complexity region 174 189 N/A INTRINSIC
low complexity region 298 316 N/A INTRINSIC
low complexity region 374 386 N/A INTRINSIC
low complexity region 390 402 N/A INTRINSIC
low complexity region 433 446 N/A INTRINSIC
Pfam:Hist_deacetyl 471 801 2.3e-91 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000120683
AA Change: Q26*
SMART Domains Protein: ENSMUSP00000112446
Gene: ENSMUSG00000022475
AA Change: Q26*

DomainStartEndE-ValueType
low complexity region 57 71 N/A INTRINSIC
low complexity region 75 91 N/A INTRINSIC
low complexity region 129 147 N/A INTRINSIC
low complexity region 198 213 N/A INTRINSIC
low complexity region 322 340 N/A INTRINSIC
low complexity region 398 410 N/A INTRINSIC
low complexity region 414 426 N/A INTRINSIC
low complexity region 457 470 N/A INTRINSIC
Pfam:Hist_deacetyl 495 623 7.9e-9 PFAM
Pfam:Hist_deacetyl 623 777 3.5e-50 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000121514
AA Change: Q26*
SMART Domains Protein: ENSMUSP00000112641
Gene: ENSMUSG00000022475
AA Change: Q26*

DomainStartEndE-ValueType
low complexity region 57 71 N/A INTRINSIC
low complexity region 75 91 N/A INTRINSIC
low complexity region 129 147 N/A INTRINSIC
low complexity region 198 213 N/A INTRINSIC
low complexity region 322 340 N/A INTRINSIC
low complexity region 392 405 N/A INTRINSIC
Pfam:Hist_deacetyl 430 760 9e-92 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000134258
SMART Domains Protein: ENSMUSP00000118599
Gene: ENSMUSG00000022475

DomainStartEndE-ValueType
low complexity region 52 64 N/A INTRINSIC
low complexity region 68 80 N/A INTRINSIC
low complexity region 111 124 N/A INTRINSIC
PDB:3ZNS|C 127 241 5e-70 PDB
SCOP:d1c3pa_ 139 219 2e-17 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000135651
SMART Domains Protein: ENSMUSP00000119970
Gene: ENSMUSG00000022475

DomainStartEndE-ValueType
low complexity region 10 22 N/A INTRINSIC
low complexity region 53 66 N/A INTRINSIC
Pfam:Hist_deacetyl 166 213 8.8e-13 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000156045
AA Change: Q48*
SMART Domains Protein: ENSMUSP00000120576
Gene: ENSMUSG00000022475
AA Change: Q48*

DomainStartEndE-ValueType
low complexity region 79 93 N/A INTRINSIC
low complexity region 97 113 N/A INTRINSIC
low complexity region 151 169 N/A INTRINSIC
low complexity region 220 235 N/A INTRINSIC
low complexity region 344 362 N/A INTRINSIC
low complexity region 420 432 N/A INTRINSIC
low complexity region 436 448 N/A INTRINSIC
low complexity region 479 492 N/A INTRINSIC
PDB:3ZNS|C 495 602 2e-60 PDB
SCOP:d1c3pa_ 507 587 6e-16 SMART
low complexity region 603 621 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000228466
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 98.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Histones play a critical role in transcriptional regulation, cell cycle progression, and developmental events. Histone acetylation/deacetylation alters chromosome structure and affects transcription factor access to DNA. The protein encoded by this gene has sequence homology to members of the histone deacetylase family. This gene is orthologous to mouse HDAC7 gene whose protein promotes repression mediated via the transcriptional corepressor SMRT. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Deletion of this gene result in embryonic lethality by E11, due to vascular defects which are due to endothelial cell adhesion defects. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acad10 T A 5: 121,652,003 T97S probably benign Het
Adam34 T A 8: 43,650,799 D603V probably benign Het
Adamts5 C T 16: 85,862,828 V859I probably benign Het
Alb T A 5: 90,472,640 D536E possibly damaging Het
Amz2 A G 11: 109,429,034 Y82C probably damaging Het
Asxl1 T C 2: 153,391,824 probably null Het
Bach1 C T 16: 87,719,857 Q429* probably null Het
Bcl6 A G 16: 23,974,865 Y111H probably damaging Het
Ccnj T C 19: 40,846,007 V338A probably benign Het
Cdca3 C T 6: 124,832,419 P174L probably damaging Het
Cdk17 T C 10: 93,211,965 L25P probably damaging Het
Cdr2 G A 7: 120,982,128 probably null Het
Cyp2c38 A T 19: 39,392,293 probably null Het
Ednra T C 8: 77,689,094 N175D probably damaging Het
Elp3 T C 14: 65,560,211 Y337C probably damaging Het
Eml2 G A 7: 19,201,163 V432I probably damaging Het
Eps15l1 A T 8: 72,368,710 probably null Het
F11r A G 1: 171,460,940 N117S probably benign Het
Foxp2 C T 6: 15,437,948 T716I probably damaging Het
Gnaq A G 19: 16,316,013 probably null Het
Gpat2 G C 2: 127,431,918 G294R possibly damaging Het
Gpr158 T C 2: 21,826,288 M733T probably damaging Het
Hmga2 G A 10: 120,370,707 probably benign Het
Itgb7 A G 15: 102,224,451 V142A probably benign Het
Kif5a T C 10: 127,242,775 N334D probably damaging Het
Lrrc47 T C 4: 154,015,860 S298P probably benign Het
Map3k1 A T 13: 111,750,530 S1415R probably damaging Het
Mdn1 T A 4: 32,670,607 L424Q probably damaging Het
Numb A C 12: 83,803,974 L154R probably damaging Het
Olfr1076 A G 2: 86,509,037 K193E probably benign Het
Olfr944 T C 9: 39,217,978 V207A probably benign Het
Pdcd5 G T 7: 35,646,909 A92E possibly damaging Het
Pdcl2 C T 5: 76,331,008 probably null Het
Rbfa T C 18: 80,192,781 Y251C probably damaging Het
Rgsl1 G A 1: 153,827,545 T120I possibly damaging Het
Serpina3g A G 12: 104,240,396 Q152R probably null Het
Setx T C 2: 29,173,558 S2289P probably damaging Het
Slc6a16 A G 7: 45,257,593 probably null Het
Slco1a6 C T 6: 142,109,379 D280N probably benign Het
Syde2 T A 3: 145,998,813 Y240N probably damaging Het
Synpo2 G A 3: 123,113,049 Q873* probably null Het
Tlr2 A G 3: 83,836,994 V594A probably benign Het
Ttc16 C T 2: 32,767,549 A512T probably damaging Het
Tubb5 T C 17: 35,838,046 E3G probably damaging Het
Vmn2r112 T C 17: 22,605,155 Y464H probably damaging Het
Xcr1 T A 9: 123,855,782 H305L probably damaging Het
Yars T G 4: 129,196,978 probably null Het
Other mutations in Hdac7
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00435:Hdac7 APN 15 97809495 missense probably damaging 0.98
IGL01011:Hdac7 APN 15 97793935 missense possibly damaging 0.83
IGL01361:Hdac7 APN 15 97811442 missense possibly damaging 0.85
IGL01474:Hdac7 APN 15 97797939 critical splice donor site probably null
IGL02314:Hdac7 APN 15 97809004 missense probably damaging 1.00
IGL02379:Hdac7 APN 15 97808385 missense probably damaging 0.99
IGL02665:Hdac7 APN 15 97796957 unclassified probably benign
IGL03010:Hdac7 APN 15 97793929 critical splice donor site probably null
IGL03023:Hdac7 APN 15 97797957 missense probably damaging 1.00
IGL03081:Hdac7 APN 15 97798306 missense probably damaging 1.00
Cairn UTSW 15 97808495 frame shift probably null
Signpost UTSW 15 97802747 missense probably damaging 1.00
R0285:Hdac7 UTSW 15 97798222 critical splice donor site probably null
R0518:Hdac7 UTSW 15 97806499 nonsense probably null
R0521:Hdac7 UTSW 15 97806499 nonsense probably null
R0522:Hdac7 UTSW 15 97806679 splice site probably null
R1543:Hdac7 UTSW 15 97809529 splice site probably benign
R1623:Hdac7 UTSW 15 97808404 nonsense probably null
R1665:Hdac7 UTSW 15 97806525 missense probably damaging 1.00
R1844:Hdac7 UTSW 15 97807976 missense probably damaging 0.98
R1895:Hdac7 UTSW 15 97796886 missense probably damaging 1.00
R1975:Hdac7 UTSW 15 97806505 nonsense probably null
R1976:Hdac7 UTSW 15 97806505 nonsense probably null
R2038:Hdac7 UTSW 15 97798270 missense probably damaging 1.00
R2155:Hdac7 UTSW 15 97794063 missense probably benign 0.00
R2156:Hdac7 UTSW 15 97794063 missense probably benign 0.00
R2263:Hdac7 UTSW 15 97810851 critical splice donor site probably null
R3546:Hdac7 UTSW 15 97808009 missense probably damaging 1.00
R4438:Hdac7 UTSW 15 97807715 missense probably damaging 1.00
R4642:Hdac7 UTSW 15 97806516 missense probably damaging 1.00
R4704:Hdac7 UTSW 15 97796216 missense probably damaging 1.00
R4705:Hdac7 UTSW 15 97811587 missense probably damaging 0.99
R5303:Hdac7 UTSW 15 97798018 missense probably damaging 0.97
R5577:Hdac7 UTSW 15 97811455 missense probably benign 0.09
R5966:Hdac7 UTSW 15 97802491 missense probably damaging 1.00
R5974:Hdac7 UTSW 15 97802072 splice site probably null
R6270:Hdac7 UTSW 15 97808495 frame shift probably null
R6835:Hdac7 UTSW 15 97802747 missense probably damaging 1.00
R6869:Hdac7 UTSW 15 97796176 missense probably damaging 1.00
R7261:Hdac7 UTSW 15 97806534 missense probably benign
R7338:Hdac7 UTSW 15 97810022 missense probably benign 0.30
R7414:Hdac7 UTSW 15 97808511 missense probably benign 0.00
R7753:Hdac7 UTSW 15 97800761 missense possibly damaging 0.93
R7753:Hdac7 UTSW 15 97806488 missense probably benign 0.00
X0028:Hdac7 UTSW 15 97809008 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CGAAGTTCTTGCTCCTGCTG -3'
(R):5'- ATTCAGTAGTCTCTGACCAAGTCC -3'

Sequencing Primer
(F):5'- AGCTCCGGCATTGGTGG -3'
(R):5'- TCTGACCAAGTCCCTGCAG -3'
Posted On2018-05-04