Incidental Mutation 'R6384:Itgb7'
ID515519
Institutional Source Beutler Lab
Gene Symbol Itgb7
Ensembl Gene ENSMUSG00000001281
Gene Nameintegrin beta 7
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.172) question?
Stock #R6384 (G1)
Quality Score225.009
Status Not validated
Chromosome15
Chromosomal Location102215995-102231944 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 102224451 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 142 (V142A)
Ref Sequence ENSEMBL: ENSMUSP00000001327 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000001327] [ENSMUST00000127014] [ENSMUST00000230652]
Predicted Effect probably benign
Transcript: ENSMUST00000001327
AA Change: V142A

PolyPhen 2 Score 0.044 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000001327
Gene: ENSMUSG00000001281
AA Change: V142A

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
PSI 44 92 6.35e-6 SMART
INB 50 476 2.82e-273 SMART
VWA 151 383 7.52e-2 SMART
low complexity region 537 557 N/A INTRINSIC
Pfam:EGF_2 605 635 2.6e-7 PFAM
Integrin_B_tail 645 721 4.22e-18 SMART
low complexity region 732 744 N/A INTRINSIC
Integrin_b_cyt 746 792 7.82e-22 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000127014
SMART Domains Protein: ENSMUSP00000123227
Gene: ENSMUSG00000001281

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
PSI 48 85 4.67e-1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000230652
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 98.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that is a member of the integrin superfamily. Members of this family are adhesion receptors that function in signaling from the extracellular matrix to the cell. Integrins are heterodimeric integral membrane proteins composed of an alpha chain and a beta chain. The encoded protein forms dimers with an alpha4 chain or an alphaE chain and plays a role in leukocyte adhesion. Dimerization with alpha4 forms a homing receptor for migration of lymphocytes to the intestinal mucosa and Peyer's patches. Dimerization with alphaE permits binding to the ligand epithelial cadherin, a calcium-dependent adhesion molecule. Alternate splicing results in multiple transcript variants. Additional alternatively spliced transcript variants of this gene have been described, but their full-length nature is not known. [provided by RefSeq, Sep 2013]
PHENOTYPE: Homozygous null mice display hypoplasia of gut-associated lymph tissue due to defects in lymphocyte migration [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acad10 T A 5: 121,652,003 T97S probably benign Het
Adam34 T A 8: 43,650,799 D603V probably benign Het
Adamts5 C T 16: 85,862,828 V859I probably benign Het
Alb T A 5: 90,472,640 D536E possibly damaging Het
Amz2 A G 11: 109,429,034 Y82C probably damaging Het
Asxl1 T C 2: 153,391,824 probably null Het
Bach1 C T 16: 87,719,857 Q429* probably null Het
Bcl6 A G 16: 23,974,865 Y111H probably damaging Het
Ccnj T C 19: 40,846,007 V338A probably benign Het
Cdca3 C T 6: 124,832,419 P174L probably damaging Het
Cdk17 T C 10: 93,211,965 L25P probably damaging Het
Cdr2 G A 7: 120,982,128 probably null Het
Cyp2c38 A T 19: 39,392,293 probably null Het
Ednra T C 8: 77,689,094 N175D probably damaging Het
Elp3 T C 14: 65,560,211 Y337C probably damaging Het
Eml2 G A 7: 19,201,163 V432I probably damaging Het
Eps15l1 A T 8: 72,368,710 probably null Het
F11r A G 1: 171,460,940 N117S probably benign Het
Foxp2 C T 6: 15,437,948 T716I probably damaging Het
Gnaq A G 19: 16,316,013 probably null Het
Gpat2 G C 2: 127,431,918 G294R possibly damaging Het
Gpr158 T C 2: 21,826,288 M733T probably damaging Het
Hdac7 G A 15: 97,811,506 Q48* probably null Het
Hmga2 G A 10: 120,370,707 probably benign Het
Kif5a T C 10: 127,242,775 N334D probably damaging Het
Lrrc47 T C 4: 154,015,860 S298P probably benign Het
Map3k1 A T 13: 111,750,530 S1415R probably damaging Het
Mdn1 T A 4: 32,670,607 L424Q probably damaging Het
Numb A C 12: 83,803,974 L154R probably damaging Het
Olfr1076 A G 2: 86,509,037 K193E probably benign Het
Olfr944 T C 9: 39,217,978 V207A probably benign Het
Pdcd5 G T 7: 35,646,909 A92E possibly damaging Het
Pdcl2 C T 5: 76,331,008 probably null Het
Rbfa T C 18: 80,192,781 Y251C probably damaging Het
Rgsl1 G A 1: 153,827,545 T120I possibly damaging Het
Serpina3g A G 12: 104,240,396 Q152R probably null Het
Setx T C 2: 29,173,558 S2289P probably damaging Het
Slc6a16 A G 7: 45,257,593 probably null Het
Slco1a6 C T 6: 142,109,379 D280N probably benign Het
Syde2 T A 3: 145,998,813 Y240N probably damaging Het
Synpo2 G A 3: 123,113,049 Q873* probably null Het
Tlr2 A G 3: 83,836,994 V594A probably benign Het
Ttc16 C T 2: 32,767,549 A512T probably damaging Het
Tubb5 T C 17: 35,838,046 E3G probably damaging Het
Vmn2r112 T C 17: 22,605,155 Y464H probably damaging Het
Xcr1 T A 9: 123,855,782 H305L probably damaging Het
Yars T G 4: 129,196,978 probably null Het
Other mutations in Itgb7
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01012:Itgb7 APN 15 102227585 missense probably benign 0.22
IGL01574:Itgb7 APN 15 102227540 missense possibly damaging 0.83
IGL01814:Itgb7 APN 15 102223417 missense possibly damaging 0.78
IGL01875:Itgb7 APN 15 102217995 missense probably damaging 1.00
IGL01996:Itgb7 APN 15 102217977 missense probably damaging 1.00
IGL02320:Itgb7 APN 15 102224337 missense probably benign 0.04
IGL02541:Itgb7 APN 15 102223457 missense probably benign 0.05
IGL02547:Itgb7 APN 15 102218510 missense probably damaging 1.00
R0083:Itgb7 UTSW 15 102223482 missense probably damaging 0.98
R0108:Itgb7 UTSW 15 102223482 missense probably damaging 0.98
R0195:Itgb7 UTSW 15 102222183 unclassified probably benign
R1033:Itgb7 UTSW 15 102223554 missense probably damaging 1.00
R1627:Itgb7 UTSW 15 102223476 missense probably damaging 0.97
R1999:Itgb7 UTSW 15 102222118 missense probably damaging 1.00
R2150:Itgb7 UTSW 15 102222118 missense probably damaging 1.00
R2331:Itgb7 UTSW 15 102223548 missense probably damaging 1.00
R3747:Itgb7 UTSW 15 102222777 missense probably damaging 1.00
R4758:Itgb7 UTSW 15 102216207 missense probably benign 0.07
R4779:Itgb7 UTSW 15 102224413 missense possibly damaging 0.54
R5134:Itgb7 UTSW 15 102217407 missense probably damaging 1.00
R5158:Itgb7 UTSW 15 102217029 missense probably benign 0.05
R5323:Itgb7 UTSW 15 102231624 intron probably benign
R5416:Itgb7 UTSW 15 102217309 missense probably benign 0.00
R5652:Itgb7 UTSW 15 102216203 missense possibly damaging 0.48
R6089:Itgb7 UTSW 15 102217286 missense probably benign 0.00
R6144:Itgb7 UTSW 15 102223482 missense probably benign 0.45
R6475:Itgb7 UTSW 15 102216266 missense probably benign 0.12
R6754:Itgb7 UTSW 15 102216160 makesense probably null
R6857:Itgb7 UTSW 15 102223465 missense probably damaging 1.00
R7394:Itgb7 UTSW 15 102219254 missense probably damaging 1.00
R7747:Itgb7 UTSW 15 102216604 missense possibly damaging 0.88
R8014:Itgb7 UTSW 15 102222652 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCGAGTCTGTTAAATACTGGGAGAG -3'
(R):5'- ACAGAACTTCACTGCCTCGG -3'

Sequencing Primer
(F):5'- CAGTGACAAGGGCTGGC -3'
(R):5'- AGGTGCTGCAGGACAAGCC -3'
Posted On2018-05-04