Incidental Mutation 'R6384:Bach1'
ID515522
Institutional Source Beutler Lab
Gene Symbol Bach1
Ensembl Gene ENSMUSG00000025612
Gene NameBTB and CNC homology 1, basic leucine zipper transcription factor 1
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6384 (G1)
Quality Score225.009
Status Not validated
Chromosome16
Chromosomal Location87698945-87733346 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) C to T at 87719857 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Stop codon at position 429 (Q429*)
Ref Sequence ENSEMBL: ENSMUSP00000026703 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000026703]
PDB Structure
Structure of mouse Bach1 BTB domain [X-RAY DIFFRACTION]
Predicted Effect probably null
Transcript: ENSMUST00000026703
AA Change: Q429*
SMART Domains Protein: ENSMUSP00000026703
Gene: ENSMUSG00000025612
AA Change: Q429*

DomainStartEndE-ValueType
BTB 34 130 1.23e-24 SMART
Blast:BTB 153 235 2e-29 BLAST
low complexity region 378 390 N/A INTRINSIC
low complexity region 504 517 N/A INTRINSIC
BRLZ 556 622 1.2e-12 SMART
low complexity region 699 717 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000151046
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156958
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 98.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a transcription factor that belongs to the cap'n'collar type of basic region leucine zipper factor family (CNC-bZip). The encoded protein contains broad complex, tramtrack, bric-a-brac/poxvirus and zinc finger (BTB/POZ) domains, which is atypical of CNC-bZip family members. These BTB/POZ domains facilitate protein-protein interactions and formation of homo- and/or hetero-oligomers. When this encoded protein forms a heterodimer with MafK, it functions as a repressor of Maf recognition element (MARE) and transcription is repressed. Multiple alternatively spliced transcript variants have been identified for this gene. [provided by RefSeq, May 2009]
PHENOTYPE: Homozygous null mice are healthy and fertile with no gross abnormalities but express elevated levels of HMOX1. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acad10 T A 5: 121,652,003 T97S probably benign Het
Adam34 T A 8: 43,650,799 D603V probably benign Het
Adamts5 C T 16: 85,862,828 V859I probably benign Het
Alb T A 5: 90,472,640 D536E possibly damaging Het
Amz2 A G 11: 109,429,034 Y82C probably damaging Het
Asxl1 T C 2: 153,391,824 probably null Het
Bcl6 A G 16: 23,974,865 Y111H probably damaging Het
Ccnj T C 19: 40,846,007 V338A probably benign Het
Cdca3 C T 6: 124,832,419 P174L probably damaging Het
Cdk17 T C 10: 93,211,965 L25P probably damaging Het
Cdr2 G A 7: 120,982,128 probably null Het
Cyp2c38 A T 19: 39,392,293 probably null Het
Ednra T C 8: 77,689,094 N175D probably damaging Het
Elp3 T C 14: 65,560,211 Y337C probably damaging Het
Eml2 G A 7: 19,201,163 V432I probably damaging Het
Eps15l1 A T 8: 72,368,710 probably null Het
F11r A G 1: 171,460,940 N117S probably benign Het
Foxp2 C T 6: 15,437,948 T716I probably damaging Het
Gnaq A G 19: 16,316,013 probably null Het
Gpat2 G C 2: 127,431,918 G294R possibly damaging Het
Gpr158 T C 2: 21,826,288 M733T probably damaging Het
Hdac7 G A 15: 97,811,506 Q48* probably null Het
Hmga2 G A 10: 120,370,707 probably benign Het
Itgb7 A G 15: 102,224,451 V142A probably benign Het
Kif5a T C 10: 127,242,775 N334D probably damaging Het
Lrrc47 T C 4: 154,015,860 S298P probably benign Het
Map3k1 A T 13: 111,750,530 S1415R probably damaging Het
Mdn1 T A 4: 32,670,607 L424Q probably damaging Het
Numb A C 12: 83,803,974 L154R probably damaging Het
Olfr1076 A G 2: 86,509,037 K193E probably benign Het
Olfr944 T C 9: 39,217,978 V207A probably benign Het
Pdcd5 G T 7: 35,646,909 A92E possibly damaging Het
Pdcl2 C T 5: 76,331,008 probably null Het
Rbfa T C 18: 80,192,781 Y251C probably damaging Het
Rgsl1 G A 1: 153,827,545 T120I possibly damaging Het
Serpina3g A G 12: 104,240,396 Q152R probably null Het
Setx T C 2: 29,173,558 S2289P probably damaging Het
Slc6a16 A G 7: 45,257,593 probably null Het
Slco1a6 C T 6: 142,109,379 D280N probably benign Het
Syde2 T A 3: 145,998,813 Y240N probably damaging Het
Synpo2 G A 3: 123,113,049 Q873* probably null Het
Tlr2 A G 3: 83,836,994 V594A probably benign Het
Ttc16 C T 2: 32,767,549 A512T probably damaging Het
Tubb5 T C 17: 35,838,046 E3G probably damaging Het
Vmn2r112 T C 17: 22,605,155 Y464H probably damaging Het
Xcr1 T A 9: 123,855,782 H305L probably damaging Het
Yars T G 4: 129,196,978 probably null Het
Other mutations in Bach1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01553:Bach1 APN 16 87722505 missense probably damaging 1.00
R0626:Bach1 UTSW 16 87729471 missense possibly damaging 0.94
R0701:Bach1 UTSW 16 87719989 missense probably damaging 0.99
R1070:Bach1 UTSW 16 87720121 missense probably benign 0.02
R1160:Bach1 UTSW 16 87715434 missense probably benign 0.34
R2066:Bach1 UTSW 16 87729625 missense probably damaging 0.99
R2235:Bach1 UTSW 16 87720113 missense probably damaging 1.00
R4716:Bach1 UTSW 16 87715379 start gained probably benign
R4801:Bach1 UTSW 16 87722452 missense probably damaging 0.99
R4802:Bach1 UTSW 16 87722452 missense probably damaging 0.99
R4989:Bach1 UTSW 16 87719000 missense possibly damaging 0.94
R5016:Bach1 UTSW 16 87719318 missense possibly damaging 0.88
R5527:Bach1 UTSW 16 87719545 missense probably benign 0.01
R5657:Bach1 UTSW 16 87719285 missense probably benign 0.00
R6064:Bach1 UTSW 16 87729864 missense probably damaging 1.00
R7009:Bach1 UTSW 16 87719291 missense probably benign 0.10
R7027:Bach1 UTSW 16 87719291 missense probably benign 0.10
R7028:Bach1 UTSW 16 87719291 missense probably benign 0.10
R7029:Bach1 UTSW 16 87719291 missense probably benign 0.10
R7030:Bach1 UTSW 16 87719291 missense probably benign 0.10
R7095:Bach1 UTSW 16 87719291 missense probably benign 0.10
R7096:Bach1 UTSW 16 87719291 missense probably benign 0.10
R7192:Bach1 UTSW 16 87729663 missense possibly damaging 0.71
R7385:Bach1 UTSW 16 87729497 missense probably damaging 0.99
R7571:Bach1 UTSW 16 87719291 missense probably benign 0.10
R7572:Bach1 UTSW 16 87719291 missense probably benign 0.10
R7623:Bach1 UTSW 16 87719291 missense probably benign 0.10
R7632:Bach1 UTSW 16 87720143 missense probably benign 0.00
R7714:Bach1 UTSW 16 87718848 nonsense probably null
R7715:Bach1 UTSW 16 87719971 missense possibly damaging 0.82
R7746:Bach1 UTSW 16 87729633 missense probably benign 0.00
R7896:Bach1 UTSW 16 87719005 missense possibly damaging 0.63
R8129:Bach1 UTSW 16 87722426 missense possibly damaging 0.51
R8169:Bach1 UTSW 16 87722502 missense possibly damaging 0.93
R8296:Bach1 UTSW 16 87729579 missense probably damaging 1.00
R8300:Bach1 UTSW 16 87719108 missense probably benign
Predicted Primers PCR Primer
(F):5'- GCATGGGCCCTAAAGAAGAC -3'
(R):5'- AGTCATCTCCCAGGCTAATCAC -3'

Sequencing Primer
(F):5'- AGACAGCAGCAGCCTTG -3'
(R):5'- GGCTCCGAGACATAATCGTAGTTTC -3'
Posted On2018-05-04