Incidental Mutation 'R6384:Tubb5'
ID515524
Institutional Source Beutler Lab
Gene Symbol Tubb5
Ensembl Gene ENSMUSG00000001525
Gene Nametubulin, beta 5 class I
SynonymsB130022C14Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.954) question?
Stock #R6384 (G1)
Quality Score225.009
Status Not validated
Chromosome17
Chromosomal Location35833921-35838306 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 35838046 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 3 (E3G)
Ref Sequence ENSEMBL: ENSMUSP00000001566 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000001566] [ENSMUST00000082337] [ENSMUST00000134978] [ENSMUST00000174124]
Predicted Effect probably damaging
Transcript: ENSMUST00000001566
AA Change: E3G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000001566
Gene: ENSMUSG00000001525
AA Change: E3G

DomainStartEndE-ValueType
Tubulin 47 244 6.29e-67 SMART
Tubulin_C 246 383 7.25e-49 SMART
low complexity region 428 444 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000082337
SMART Domains Protein: ENSMUSP00000080949
Gene: ENSMUSG00000061607

DomainStartEndE-ValueType
low complexity region 12 18 N/A INTRINSIC
FHA 53 105 5.63e-9 SMART
low complexity region 194 215 N/A INTRINSIC
low complexity region 854 870 N/A INTRINSIC
low complexity region 969 987 N/A INTRINSIC
low complexity region 1008 1022 N/A INTRINSIC
internal_repeat_1 1027 1115 6.7e-11 PROSPERO
internal_repeat_2 1030 1141 2.36e-9 PROSPERO
internal_repeat_1 1266 1354 6.7e-11 PROSPERO
internal_repeat_2 1298 1417 2.36e-9 PROSPERO
low complexity region 1422 1445 N/A INTRINSIC
low complexity region 1457 1477 N/A INTRINSIC
BRCT 1502 1579 1.66e-1 SMART
BRCT 1612 1691 2.45e1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000134978
SMART Domains Protein: ENSMUSP00000134598
Gene: ENSMUSG00000001525

DomainStartEndE-ValueType
Pfam:Tubulin 1 67 1.6e-20 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156050
Predicted Effect noncoding transcript
Transcript: ENSMUST00000173253
Predicted Effect probably benign
Transcript: ENSMUST00000174124
SMART Domains Protein: ENSMUSP00000133568
Gene: ENSMUSG00000061607

DomainStartEndE-ValueType
low complexity region 12 18 N/A INTRINSIC
FHA 53 105 5.63e-9 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 98.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a beta tubulin protein. This protein forms a dimer with alpha tubulin and acts as a structural component of microtubules. Mutations in this gene cause cortical dysplasia, complex, with other brain malformations 6. Alternative splicing results in multiple splice variants. There are multiple pseudogenes for this gene on chromosomes 1, 6, 7, 8, 9, and 13. [provided by RefSeq, Jun 2014]
PHENOTYPE: Mice homozygous for a conditional knock-in or knock-out allele exhibit microcephaly due to upper-layer loss, delayed cell cycle progression and apoptosis of neurons. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acad10 T A 5: 121,652,003 T97S probably benign Het
Adam34 T A 8: 43,650,799 D603V probably benign Het
Adamts5 C T 16: 85,862,828 V859I probably benign Het
Alb T A 5: 90,472,640 D536E possibly damaging Het
Amz2 A G 11: 109,429,034 Y82C probably damaging Het
Asxl1 T C 2: 153,391,824 probably null Het
Bach1 C T 16: 87,719,857 Q429* probably null Het
Bcl6 A G 16: 23,974,865 Y111H probably damaging Het
Ccnj T C 19: 40,846,007 V338A probably benign Het
Cdca3 C T 6: 124,832,419 P174L probably damaging Het
Cdk17 T C 10: 93,211,965 L25P probably damaging Het
Cdr2 G A 7: 120,982,128 probably null Het
Cyp2c38 A T 19: 39,392,293 probably null Het
Ednra T C 8: 77,689,094 N175D probably damaging Het
Elp3 T C 14: 65,560,211 Y337C probably damaging Het
Eml2 G A 7: 19,201,163 V432I probably damaging Het
Eps15l1 A T 8: 72,368,710 probably null Het
F11r A G 1: 171,460,940 N117S probably benign Het
Foxp2 C T 6: 15,437,948 T716I probably damaging Het
Gnaq A G 19: 16,316,013 probably null Het
Gpat2 G C 2: 127,431,918 G294R possibly damaging Het
Gpr158 T C 2: 21,826,288 M733T probably damaging Het
Hdac7 G A 15: 97,811,506 Q48* probably null Het
Hmga2 G A 10: 120,370,707 probably benign Het
Itgb7 A G 15: 102,224,451 V142A probably benign Het
Kif5a T C 10: 127,242,775 N334D probably damaging Het
Lrrc47 T C 4: 154,015,860 S298P probably benign Het
Map3k1 A T 13: 111,750,530 S1415R probably damaging Het
Mdn1 T A 4: 32,670,607 L424Q probably damaging Het
Numb A C 12: 83,803,974 L154R probably damaging Het
Olfr1076 A G 2: 86,509,037 K193E probably benign Het
Olfr944 T C 9: 39,217,978 V207A probably benign Het
Pdcd5 G T 7: 35,646,909 A92E possibly damaging Het
Pdcl2 C T 5: 76,331,008 probably null Het
Rbfa T C 18: 80,192,781 Y251C probably damaging Het
Rgsl1 G A 1: 153,827,545 T120I possibly damaging Het
Serpina3g A G 12: 104,240,396 Q152R probably null Het
Setx T C 2: 29,173,558 S2289P probably damaging Het
Slc6a16 A G 7: 45,257,593 probably null Het
Slco1a6 C T 6: 142,109,379 D280N probably benign Het
Syde2 T A 3: 145,998,813 Y240N probably damaging Het
Synpo2 G A 3: 123,113,049 Q873* probably null Het
Tlr2 A G 3: 83,836,994 V594A probably benign Het
Ttc16 C T 2: 32,767,549 A512T probably damaging Het
Vmn2r112 T C 17: 22,605,155 Y464H probably damaging Het
Xcr1 T A 9: 123,855,782 H305L probably damaging Het
Yars T G 4: 129,196,978 probably null Het
Other mutations in Tubb5
AlleleSourceChrCoordTypePredicted EffectPPH Score
tubular UTSW 17 35835842 missense probably damaging 0.99
R1666:Tubb5 UTSW 17 35836638 missense probably benign 0.05
R1920:Tubb5 UTSW 17 35835298 missense probably benign 0.13
R1922:Tubb5 UTSW 17 35835298 missense probably benign 0.13
R5508:Tubb5 UTSW 17 35835070 missense probably benign 0.01
R6326:Tubb5 UTSW 17 35836455 unclassified probably benign
R6478:Tubb5 UTSW 17 35835842 missense probably damaging 0.99
R8110:Tubb5 UTSW 17 35838275 unclassified probably benign
X0027:Tubb5 UTSW 17 35836691 missense probably benign
Z1176:Tubb5 UTSW 17 35835356 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- ATTAGCTTTCCGAAAATGTGCC -3'
(R):5'- TTAGAACCTTCCTGCGGTCG -3'

Sequencing Primer
(F):5'- TCAGAACGCTAGCTACAAATATGG -3'
(R):5'- CGGTCGTGCTTGCATCTCG -3'
Posted On2018-05-04