Mutagenetix > Incidental Mutation

Incidental Mutation 'R6385:Fut9'

515544

Institutional Source

Beutler Lab

Gene Symbol

Fut9

Ensembl Gene

ENSMUSG00000055373

Gene Name

fucosyltransferase 9

Synonyms

mFuc-TIX, mFUT9

MMRRC Submission

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R6385 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

25609332-25800244 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to A at 25620328 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Serine to Leucine at position 162 (S162L)

Ref Sequence

ENSEMBL: ENSMUSP00000103834 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000084770] [ENSMUST00000108199]

AlphaFold

O88819

Predicted Effect

probably damaging
Transcript: ENSMUST00000084770
AA Change: S162L

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000081826
Gene: ENSMUSG00000055373
AA Change: S162L

Domain	Start	End	E-Value	Type
Pfam:Glyco_transf_10	6	358	2.9e-140	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000108199
AA Change: S162L

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000103834
Gene: ENSMUSG00000055373
AA Change: S162L

Domain	Start	End	E-Value	Type
transmembrane domain	7	29	N/A	INTRINSIC
Pfam:Glyco_tran_10_N	61	169	1.4e-43	PFAM
Pfam:Glyco_transf_10	185	357	4.8e-69	PFAM

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.3%
20x: 97.4%

Validation Efficiency

98% (55/56)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the glycosyltransferase family. It is localized to the golgi, and catalyzes the last step in the biosynthesis of Lewis X (LeX) antigen, the addition of a fucose to precursor polysaccharides. This protein is one of the few fucosyltransferases that synthesizes the LeX oligosaccharide (CD15) expressed in the organ buds progressing in mesenchyma during embryogenesis. It is also responsible for the expression of CD15 in mature granulocytes. A common haplotype of this gene has also been associated with susceptibility to placental malaria infection. [provided by RefSeq, Nov 2011]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit increased number of neuronal stem cells with increased self-renewal capacity. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 57 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
3425401B19Rik	T	A	14: 32,661,279	M910L	probably benign	Het
Abca9	T	A	11: 110,134,254	I988F	probably damaging	Het
Adgra2	A	T	8: 27,118,850	S92C	probably damaging	Het
Apon	A	G	10: 128,254,354		probably benign	Het
Arap3	G	A	18: 37,997,031	R26*	probably null	Het
BC049730	A	T	7: 24,714,110	I184F	probably damaging	Het
Btnl6	T	G	17: 34,508,369	I396L	probably benign	Het
Catsper3	G	T	13: 55,786,426	Q53H	probably damaging	Het
Cep164	T	G	9: 45,779,783	E372A	probably damaging	Het
Cln3	A	T	7: 126,575,035	C339S	probably null	Het
Cntnap2	G	A	6: 46,856,180	D776N	probably benign	Het
Cttnbp2nl	A	G	3: 105,005,636	F311L	probably benign	Het
Daam2	C	T	17: 49,463,936	A918T	probably damaging	Het
Dst	T	C	1: 34,307,468	V7353A	possibly damaging	Het
Enpp5	G	A	17: 44,085,264	G356S	probably damaging	Het
Fanca	A	T	8: 123,305,867		probably null	Het
Filip1	G	T	9: 79,820,531	Q269K	possibly damaging	Het
Gtf2ird1	A	T	5: 134,404,690	H294Q	probably benign	Het
Gucy1a1	A	G	3: 82,109,006	I225T	probably benign	Het
H2-DMb1	T	A	17: 34,155,602	N75K	probably benign	Het
Helz2	C	T	2: 181,233,467	E1745K	probably damaging	Het
Hes1	A	G	16: 30,065,606	M6V	possibly damaging	Het
Hydin	A	T	8: 110,312,224	H198L	possibly damaging	Het
Iars	T	C	13: 49,701,895	L266P	probably damaging	Het
Ifna11	A	G	4: 88,820,149	E64G	probably damaging	Het
Inpp5d	T	A	1: 87,699,675	L566Q	probably damaging	Het
Kcnh3	T	C	15: 99,227,941	S160P	probably benign	Het
Lama5	T	C	2: 180,196,533	T850A	probably damaging	Het
Lgi3	A	G	14: 70,531,170	T36A	possibly damaging	Het
Lrp2	T	C	2: 69,495,784	S1810G	probably benign	Het
Msln	T	A	17: 25,751,141	D280V	probably benign	Het
Myh4	A	T	11: 67,255,837	I1513F	probably damaging	Het
Ncf2	A	T	1: 152,830,422	M262L	probably benign	Het
Neb	G	T	2: 52,185,299	A218D	probably damaging	Het
Notch4	C	A	17: 34,573,814	Q640K	probably null	Het
Olfr1303	T	C	2: 111,814,619	I36V	probably benign	Het
Olfr231	A	T	1: 174,117,296	F240Y	probably damaging	Het
Olfr603	A	T	7: 103,383,897	V35D	possibly damaging	Het
Pear1	G	T	3: 87,754,199	H562N	probably benign	Het
Poli	C	A	18: 70,530,001		probably benign	Het
Ppp3r2	A	G	4: 49,681,767	I61T	possibly damaging	Het
Rfc5	T	C	5: 117,385,398	T112A	probably benign	Het
Serhl	A	G	15: 83,101,622	T5A	probably benign	Het
Shank3	T	C	15: 89,521,375		probably null	Het
Slc22a28	A	G	19: 8,101,480	S282P	probably damaging	Het
Slc2a12	C	T	10: 22,694,030	T540I	possibly damaging	Het
Slurp2	T	C	15: 74,746,675	M1V	probably null	Het
St3gal1	A	G	15: 67,111,346	V187A	possibly damaging	Het
Tln2	C	T	9: 67,278,129	A700T	probably benign	Het
Ttn	C	T	2: 76,917,848	V4286I	probably benign	Het
Ube2u	A	G	4: 100,532,144	K214R	possibly damaging	Het
Vmn1r46	A	G	6: 89,976,445	H92R	probably damaging	Het
Wdr90	A	G	17: 25,848,530	I1486T	probably damaging	Het
Zc3h11a	A	T	1: 133,637,454	S236T	possibly damaging	Het
Zfp318	A	G	17: 46,411,006	K1312E	probably damaging	Het
Zfp930	A	G	8: 69,228,631	Y326C	probably damaging	Het
Zfp972	G	T	2: 177,921,795	D8E	probably damaging	Het

Other mutations in Fut9

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00919:Fut9	APN	4	25620316	missense	possibly damaging	0.71
IGL01134:Fut9	APN	4	25620446	missense	probably benign	0.13
IGL01330:Fut9	APN	4	25619791	missense	possibly damaging	0.95
IGL01732:Fut9	APN	4	25619867	missense	possibly damaging	0.58
IGL02824:Fut9	APN	4	25620037	missense	probably damaging	1.00
ANU74:Fut9	UTSW	4	25620802	missense	probably benign	0.25
R0280:Fut9	UTSW	4	25619852	missense	probably benign	0.00
R0408:Fut9	UTSW	4	25620319	missense	possibly damaging	0.69
R0594:Fut9	UTSW	4	25620526	missense	possibly damaging	0.94
R0609:Fut9	UTSW	4	25620811	start codon destroyed	probably null	0.98
R0709:Fut9	UTSW	4	25620359	missense	probably damaging	1.00
R1567:Fut9	UTSW	4	25620344	missense	probably damaging	0.99
R1719:Fut9	UTSW	4	25619744	missense	possibly damaging	0.62
R1856:Fut9	UTSW	4	25620352	missense	probably damaging	1.00
R2036:Fut9	UTSW	4	25620322	missense	probably damaging	1.00
R2165:Fut9	UTSW	4	25619733	makesense	probably null
R2165:Fut9	UTSW	4	25619734	makesense	probably null
R2332:Fut9	UTSW	4	25619823	nonsense	probably null
R4539:Fut9	UTSW	4	25619793	missense	probably damaging	1.00
R4722:Fut9	UTSW	4	25799734	utr 5 prime	probably benign
R4766:Fut9	UTSW	4	25799191	intron	probably benign
R4937:Fut9	UTSW	4	25799591	splice site	probably benign
R5025:Fut9	UTSW	4	25620502	missense	probably damaging	1.00
R5032:Fut9	UTSW	4	25799245	intron	probably benign
R5158:Fut9	UTSW	4	25620731	missense	probably benign	0.01
R5601:Fut9	UTSW	4	25620299	missense	probably benign	0.00
R5974:Fut9	UTSW	4	25620090	nonsense	probably null
R6315:Fut9	UTSW	4	25619774	missense	probably damaging	1.00
R6652:Fut9	UTSW	4	25620619	missense	probably benign	0.44
R6809:Fut9	UTSW	4	25620647	missense	probably benign
R6825:Fut9	UTSW	4	25619925	missense	probably benign
R7145:Fut9	UTSW	4	25620507	missense	probably damaging	0.96
R7573:Fut9	UTSW	4	25620691	missense	probably benign	0.04
R8933:Fut9	UTSW	4	25619861	missense	probably damaging	1.00
R9715:Fut9	UTSW	4	25620679	missense	probably benign	0.00
X0057:Fut9	UTSW	4	25799686	start gained	probably benign

Predicted Primers

PCR Primer
(F):5'- TCACGTATTCTCCGAATGCTTG -3'
(R):5'- TCACAACAGACCGCTCATTG -3'

Sequencing Primer
(F):5'- TCCGAATGCTTGGCCATAG -3'
(R):5'- AAATCCCATGCGGTCCTG -3'

Posted On

2018-05-04