Incidental Mutation 'R6385:Filip1'
ID 515560
Institutional Source Beutler Lab
Gene Symbol Filip1
Ensembl Gene ENSMUSG00000034898
Gene Name filamin A interacting protein 1
Synonyms 5730485H21Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.381) question?
Stock # R6385 (G1)
Quality Score 225.009
Status Validated
Chromosome 9
Chromosomal Location 79815051-80012851 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) G to T at 79820531 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Glutamine to Lysine at position 269 (Q269K)
Ref Sequence ENSEMBL: ENSMUSP00000091329 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000093811] [ENSMUST00000172973]
AlphaFold no structure available at present
Predicted Effect possibly damaging
Transcript: ENSMUST00000093811
AA Change: Q269K

PolyPhen 2 Score 0.684 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000091329
Gene: ENSMUSG00000034898
AA Change: Q269K

DomainStartEndE-ValueType
Pfam:CortBP2 71 256 2.1e-64 PFAM
coiled coil region 258 540 N/A INTRINSIC
low complexity region 545 564 N/A INTRINSIC
low complexity region 579 592 N/A INTRINSIC
coiled coil region 625 778 N/A INTRINSIC
low complexity region 928 940 N/A INTRINSIC
low complexity region 1126 1140 N/A INTRINSIC
low complexity region 1168 1180 N/A INTRINSIC
low complexity region 1198 1214 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000172740
Predicted Effect probably benign
Transcript: ENSMUST00000172973
SMART Domains Protein: ENSMUSP00000134427
Gene: ENSMUSG00000034898

DomainStartEndE-ValueType
Pfam:CortBP2 65 225 5.2e-74 PFAM
Meta Mutation Damage Score 0.1285 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.3%
  • 20x: 97.4%
Validation Efficiency 98% (55/56)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a filamin A binding protein. The encoded protein promotes the degradation of filamin A and may regulate cortical neuron migration and dendritic spine morphology. Mice lacking a functional copy of this gene exhibit reduced dendritic spine length and altered excitatory signaling. [provided by RefSeq, Oct 2016]
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3425401B19Rik T A 14: 32,661,279 M910L probably benign Het
Abca9 T A 11: 110,134,254 I988F probably damaging Het
Adgra2 A T 8: 27,118,850 S92C probably damaging Het
Apon A G 10: 128,254,354 probably benign Het
Arap3 G A 18: 37,997,031 R26* probably null Het
BC049730 A T 7: 24,714,110 I184F probably damaging Het
Btnl6 T G 17: 34,508,369 I396L probably benign Het
Catsper3 G T 13: 55,786,426 Q53H probably damaging Het
Cep164 T G 9: 45,779,783 E372A probably damaging Het
Cln3 A T 7: 126,575,035 C339S probably null Het
Cntnap2 G A 6: 46,856,180 D776N probably benign Het
Cttnbp2nl A G 3: 105,005,636 F311L probably benign Het
Daam2 C T 17: 49,463,936 A918T probably damaging Het
Dst T C 1: 34,307,468 V7353A possibly damaging Het
Enpp5 G A 17: 44,085,264 G356S probably damaging Het
Fanca A T 8: 123,305,867 probably null Het
Fut9 G A 4: 25,620,328 S162L probably damaging Het
Gtf2ird1 A T 5: 134,404,690 H294Q probably benign Het
Gucy1a1 A G 3: 82,109,006 I225T probably benign Het
H2-DMb1 T A 17: 34,155,602 N75K probably benign Het
Helz2 C T 2: 181,233,467 E1745K probably damaging Het
Hes1 A G 16: 30,065,606 M6V possibly damaging Het
Hydin A T 8: 110,312,224 H198L possibly damaging Het
Iars T C 13: 49,701,895 L266P probably damaging Het
Ifna11 A G 4: 88,820,149 E64G probably damaging Het
Inpp5d T A 1: 87,699,675 L566Q probably damaging Het
Kcnh3 T C 15: 99,227,941 S160P probably benign Het
Lama5 T C 2: 180,196,533 T850A probably damaging Het
Lgi3 A G 14: 70,531,170 T36A possibly damaging Het
Lrp2 T C 2: 69,495,784 S1810G probably benign Het
Msln T A 17: 25,751,141 D280V probably benign Het
Myh4 A T 11: 67,255,837 I1513F probably damaging Het
Ncf2 A T 1: 152,830,422 M262L probably benign Het
Neb G T 2: 52,185,299 A218D probably damaging Het
Notch4 C A 17: 34,573,814 Q640K probably null Het
Olfr1303 T C 2: 111,814,619 I36V probably benign Het
Olfr231 A T 1: 174,117,296 F240Y probably damaging Het
Olfr603 A T 7: 103,383,897 V35D possibly damaging Het
Pear1 G T 3: 87,754,199 H562N probably benign Het
Poli C A 18: 70,530,001 probably benign Het
Ppp3r2 A G 4: 49,681,767 I61T possibly damaging Het
Rfc5 T C 5: 117,385,398 T112A probably benign Het
Serhl A G 15: 83,101,622 T5A probably benign Het
Shank3 T C 15: 89,521,375 probably null Het
Slc22a28 A G 19: 8,101,480 S282P probably damaging Het
Slc2a12 C T 10: 22,694,030 T540I possibly damaging Het
Slurp2 T C 15: 74,746,675 M1V probably null Het
St3gal1 A G 15: 67,111,346 V187A possibly damaging Het
Tln2 C T 9: 67,278,129 A700T probably benign Het
Ttn C T 2: 76,917,848 V4286I probably benign Het
Ube2u A G 4: 100,532,144 K214R possibly damaging Het
Vmn1r46 A G 6: 89,976,445 H92R probably damaging Het
Wdr90 A G 17: 25,848,530 I1486T probably damaging Het
Zc3h11a A T 1: 133,637,454 S236T possibly damaging Het
Zfp318 A G 17: 46,411,006 K1312E probably damaging Het
Zfp930 A G 8: 69,228,631 Y326C probably damaging Het
Zfp972 G T 2: 177,921,795 D8E probably damaging Het
Other mutations in Filip1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00420:Filip1 APN 9 79817944 missense probably damaging 1.00
IGL01101:Filip1 APN 9 79898246 missense probably benign 0.44
IGL01301:Filip1 APN 9 79819180 missense possibly damaging 0.93
IGL01887:Filip1 APN 9 79819617 missense probably benign 0.42
IGL02119:Filip1 APN 9 79818266 missense probably benign
IGL02285:Filip1 APN 9 79820126 missense probably damaging 1.00
IGL02395:Filip1 APN 9 79898410 missense probably benign 0.01
IGL03398:Filip1 APN 9 79818943 missense probably benign 0.03
IGL03400:Filip1 APN 9 79820473 missense probably benign 0.01
IGL03404:Filip1 APN 9 79818559 missense probably damaging 0.99
ANU18:Filip1 UTSW 9 79819180 missense possibly damaging 0.93
BB010:Filip1 UTSW 9 79820047 missense possibly damaging 0.65
BB020:Filip1 UTSW 9 79820047 missense possibly damaging 0.65
R0101:Filip1 UTSW 9 79819528 missense probably benign 0.04
R0243:Filip1 UTSW 9 79819003 missense probably damaging 0.98
R0244:Filip1 UTSW 9 79819462 missense possibly damaging 0.87
R0371:Filip1 UTSW 9 79860091 missense probably damaging 1.00
R0399:Filip1 UTSW 9 79818310 missense possibly damaging 0.71
R0412:Filip1 UTSW 9 79820289 missense possibly damaging 0.59
R0671:Filip1 UTSW 9 79819390 missense probably damaging 1.00
R1314:Filip1 UTSW 9 79820566 missense probably damaging 1.00
R1465:Filip1 UTSW 9 79898307 missense probably benign 0.25
R1465:Filip1 UTSW 9 79898307 missense probably benign 0.25
R1602:Filip1 UTSW 9 79820591 missense probably damaging 0.99
R1801:Filip1 UTSW 9 79815846 missense probably damaging 0.98
R1929:Filip1 UTSW 9 79819930 missense probably damaging 1.00
R1983:Filip1 UTSW 9 79860092 missense probably damaging 1.00
R2066:Filip1 UTSW 9 79820216 missense probably damaging 1.00
R2128:Filip1 UTSW 9 79819330 missense probably damaging 0.99
R2271:Filip1 UTSW 9 79819930 missense probably damaging 1.00
R2411:Filip1 UTSW 9 79898433 missense probably damaging 0.98
R3429:Filip1 UTSW 9 79853670 missense probably damaging 1.00
R3430:Filip1 UTSW 9 79853670 missense probably damaging 1.00
R3945:Filip1 UTSW 9 79818367 missense probably benign 0.01
R4007:Filip1 UTSW 9 79818727 missense possibly damaging 0.71
R4583:Filip1 UTSW 9 79815809 missense possibly damaging 0.76
R4803:Filip1 UTSW 9 79820114 missense probably benign 0.05
R4837:Filip1 UTSW 9 79819459 missense probably damaging 0.98
R4910:Filip1 UTSW 9 79817932 missense probably benign 0.00
R4929:Filip1 UTSW 9 79819747 missense probably benign 0.07
R5387:Filip1 UTSW 9 79818274 missense probably benign
R5581:Filip1 UTSW 9 79819760 missense possibly damaging 0.95
R5808:Filip1 UTSW 9 79818701 missense possibly damaging 0.67
R5891:Filip1 UTSW 9 79819860 missense possibly damaging 0.69
R6166:Filip1 UTSW 9 79819454 missense probably damaging 0.99
R6273:Filip1 UTSW 9 79815886 missense probably benign 0.01
R6380:Filip1 UTSW 9 79819624 missense probably damaging 0.99
R6614:Filip1 UTSW 9 79815839 missense probably damaging 1.00
R6715:Filip1 UTSW 9 79818758 missense probably benign 0.03
R7047:Filip1 UTSW 9 79853634 missense probably damaging 0.98
R7126:Filip1 UTSW 9 79898295 missense possibly damaging 0.88
R7144:Filip1 UTSW 9 79820213 missense possibly damaging 0.65
R7218:Filip1 UTSW 9 79818074 missense probably benign
R7404:Filip1 UTSW 9 79820098 missense possibly damaging 0.94
R7702:Filip1 UTSW 9 79820649 missense probably benign 0.20
R7866:Filip1 UTSW 9 79818943 missense probably benign 0.03
R7933:Filip1 UTSW 9 79820047 missense possibly damaging 0.65
R8012:Filip1 UTSW 9 79817959 missense probably damaging 0.97
R8097:Filip1 UTSW 9 79818259 missense probably benign
R8213:Filip1 UTSW 9 79818092 missense probably benign 0.01
R8305:Filip1 UTSW 9 79820475 nonsense probably null
R8798:Filip1 UTSW 9 79820090 missense possibly damaging 0.94
R9184:Filip1 UTSW 9 79898260 missense probably benign 0.03
R9322:Filip1 UTSW 9 79819732 missense probably benign 0.01
R9334:Filip1 UTSW 9 79818457 missense probably benign 0.32
R9353:Filip1 UTSW 9 79818341 missense possibly damaging 0.67
R9541:Filip1 UTSW 9 79819853 nonsense probably null
R9607:Filip1 UTSW 9 79819120 missense probably damaging 1.00
X0054:Filip1 UTSW 9 79819535 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- AGCTGCCTGTTGTGAGACTC -3'
(R):5'- CCTAACATAGAGCTTACATTCTTGTGG -3'

Sequencing Primer
(F):5'- TTGTGAGACTCTTGGTTAGCC -3'
(R):5'- GTTTAGGTTGAAAAAGCTCCTTGAG -3'
Posted On 2018-05-04