Incidental Mutation 'R6385:Slc2a12'
ID515561
Institutional Source Beutler Lab
Gene Symbol Slc2a12
Ensembl Gene ENSMUSG00000037490
Gene Namesolute carrier family 2 (facilitated glucose transporter), member 12
SynonymsGlut12, GLUT-12
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6385 (G1)
Quality Score225.009
Status Validated
Chromosome10
Chromosomal Location22645011-22704285 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 22694030 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Isoleucine at position 540 (T540I)
Ref Sequence ENSEMBL: ENSMUSP00000043962 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000042261]
Predicted Effect possibly damaging
Transcript: ENSMUST00000042261
AA Change: T540I

PolyPhen 2 Score 0.692 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000043962
Gene: ENSMUSG00000037490
AA Change: T540I

DomainStartEndE-ValueType
Pfam:MFS_1 42 390 5.3e-27 PFAM
Pfam:Sugar_tr 47 381 9.1e-76 PFAM
Pfam:Sugar_tr 451 569 4e-28 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.3%
  • 20x: 97.4%
Validation Efficiency 98% (55/56)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] SLC2A12 belongs to a family of transporters that catalyze the uptake of sugars through facilitated diffusion (Rogers et al., 2002). This family of transporters show conservation of 12 transmembrane helices as well as functionally significant amino acid residues (Joost and Thorens, 2001 [PubMed 11780753]).[supplied by OMIM, Mar 2008]
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3425401B19Rik T A 14: 32,661,279 M910L probably benign Het
Abca9 T A 11: 110,134,254 I988F probably damaging Het
Adgra2 A T 8: 27,118,850 S92C probably damaging Het
Apon A G 10: 128,254,354 probably benign Het
Arap3 G A 18: 37,997,031 R26* probably null Het
BC049730 A T 7: 24,714,110 I184F probably damaging Het
Btnl6 T G 17: 34,508,369 I396L probably benign Het
Catsper3 G T 13: 55,786,426 Q53H probably damaging Het
Cep164 T G 9: 45,779,783 E372A probably damaging Het
Cln3 A T 7: 126,575,035 C339S probably null Het
Cntnap2 G A 6: 46,856,180 D776N probably benign Het
Cttnbp2nl A G 3: 105,005,636 F311L probably benign Het
Daam2 C T 17: 49,463,936 A918T probably damaging Het
Dst T C 1: 34,307,468 V7353A possibly damaging Het
Enpp5 G A 17: 44,085,264 G356S probably damaging Het
Fanca A T 8: 123,305,867 probably null Het
Filip1 G T 9: 79,820,531 Q269K possibly damaging Het
Fut9 G A 4: 25,620,328 S162L probably damaging Het
Gtf2ird1 A T 5: 134,404,690 H294Q probably benign Het
Gucy1a1 A G 3: 82,109,006 I225T probably benign Het
H2-DMb1 T A 17: 34,155,602 N75K probably benign Het
Helz2 C T 2: 181,233,467 E1745K probably damaging Het
Hes1 A G 16: 30,065,606 M6V possibly damaging Het
Hydin A T 8: 110,312,224 H198L possibly damaging Het
Iars T C 13: 49,701,895 L266P probably damaging Het
Ifna11 A G 4: 88,820,149 E64G probably damaging Het
Inpp5d T A 1: 87,699,675 L566Q probably damaging Het
Kcnh3 T C 15: 99,227,941 S160P probably benign Het
Lama5 T C 2: 180,196,533 T850A probably damaging Het
Lgi3 A G 14: 70,531,170 T36A possibly damaging Het
Lrp2 T C 2: 69,495,784 S1810G probably benign Het
Msln T A 17: 25,751,141 D280V probably benign Het
Myh4 A T 11: 67,255,837 I1513F probably damaging Het
Ncf2 A T 1: 152,830,422 M262L probably benign Het
Neb G T 2: 52,185,299 A218D probably damaging Het
Notch4 C A 17: 34,573,814 Q640K probably null Het
Olfr1303 T C 2: 111,814,619 I36V probably benign Het
Olfr231 A T 1: 174,117,296 F240Y probably damaging Het
Olfr603 A T 7: 103,383,897 V35D possibly damaging Het
Pear1 G T 3: 87,754,199 H562N probably benign Het
Poli C A 18: 70,530,001 probably benign Het
Ppp3r2 A G 4: 49,681,767 I61T possibly damaging Het
Rfc5 T C 5: 117,385,398 T112A probably benign Het
Serhl A G 15: 83,101,622 T5A probably benign Het
Shank3 T C 15: 89,521,375 probably null Het
Slc22a28 A G 19: 8,101,480 S282P probably damaging Het
Slurp2 T C 15: 74,746,675 M1V probably null Het
St3gal1 A G 15: 67,111,346 V187A possibly damaging Het
Tln2 C T 9: 67,278,129 A700T probably benign Het
Ttn C T 2: 76,917,848 V4286I probably benign Het
Ube2u A G 4: 100,532,144 K214R possibly damaging Het
Vmn1r46 A G 6: 89,976,445 H92R probably damaging Het
Wdr90 A G 17: 25,848,530 I1486T probably damaging Het
Zc3h11a A T 1: 133,637,454 S236T possibly damaging Het
Zfp318 A G 17: 46,411,006 K1312E probably damaging Het
Zfp930 A G 8: 69,228,631 Y326C probably damaging Het
Zfp972 G T 2: 177,921,795 D8E probably damaging Het
Other mutations in Slc2a12
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01392:Slc2a12 APN 10 22664684 missense probably damaging 0.97
IGL02472:Slc2a12 APN 10 22665155 missense probably damaging 1.00
IGL03387:Slc2a12 APN 10 22665235 missense probably damaging 1.00
IGL03412:Slc2a12 APN 10 22664969 missense probably damaging 1.00
R0537:Slc2a12 UTSW 10 22665068 missense probably damaging 1.00
R0539:Slc2a12 UTSW 10 22692230 missense probably benign 0.04
R0744:Slc2a12 UTSW 10 22702016 unclassified probably benign
R0833:Slc2a12 UTSW 10 22702016 unclassified probably benign
R1056:Slc2a12 UTSW 10 22665451 missense probably benign 0.05
R1926:Slc2a12 UTSW 10 22665242 missense probably damaging 1.00
R2188:Slc2a12 UTSW 10 22664837 missense probably benign 0.01
R2471:Slc2a12 UTSW 10 22664807 missense probably damaging 1.00
R4212:Slc2a12 UTSW 10 22702094 missense probably benign 0.02
R4213:Slc2a12 UTSW 10 22702094 missense probably benign 0.02
R4543:Slc2a12 UTSW 10 22664786 missense probably damaging 1.00
R5203:Slc2a12 UTSW 10 22645314 critical splice donor site probably null
R5203:Slc2a12 UTSW 10 22692218 missense probably benign
R5223:Slc2a12 UTSW 10 22702032 missense probably damaging 0.99
R5500:Slc2a12 UTSW 10 22665137 missense probably damaging 1.00
R6119:Slc2a12 UTSW 10 22665347 missense probably damaging 1.00
R6149:Slc2a12 UTSW 10 22664502 missense probably benign 0.05
R6281:Slc2a12 UTSW 10 22665320 missense probably damaging 1.00
R6330:Slc2a12 UTSW 10 22664995 missense probably benign 0.00
R6623:Slc2a12 UTSW 10 22664900 missense probably damaging 1.00
R6895:Slc2a12 UTSW 10 22692185 missense probably damaging 1.00
R7080:Slc2a12 UTSW 10 22665317 missense probably benign 0.34
R7152:Slc2a12 UTSW 10 22665554 missense probably benign 0.00
R7592:Slc2a12 UTSW 10 22664903 missense probably damaging 1.00
R7641:Slc2a12 UTSW 10 22693994 missense probably damaging 0.98
R7674:Slc2a12 UTSW 10 22693994 missense probably damaging 0.98
R7736:Slc2a12 UTSW 10 22664818 missense probably damaging 1.00
R7822:Slc2a12 UTSW 10 22664669 missense probably damaging 1.00
Z1177:Slc2a12 UTSW 10 22645241 missense probably benign 0.06
Predicted Primers PCR Primer
(F):5'- TCACTTCCGTGGAGAGTTTTAC -3'
(R):5'- CACATCAAGGACACGGTTGG -3'

Sequencing Primer
(F):5'- CCGTGGAGAGTTTTACCATGCAC -3'
(R):5'- ATCAGGTAGACAGTCTTACAGC -3'
Posted On2018-05-04