Incidental Mutation 'R6385:Slc22a28'
ID515585
Institutional Source Beutler Lab
Gene Symbol Slc22a28
Ensembl Gene ENSMUSG00000063590
Gene Namesolute carrier family 22, member 28
SynonymsGm5631
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.408) question?
Stock #R6385 (G1)
Quality Score225.009
Status Validated
Chromosome19
Chromosomal Location8062209-8131982 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 8101480 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 282 (S282P)
Ref Sequence ENSEMBL: ENSMUSP00000067114 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000065651]
Predicted Effect probably damaging
Transcript: ENSMUST00000065651
AA Change: S282P

PolyPhen 2 Score 0.990 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000067114
Gene: ENSMUSG00000063590
AA Change: S282P

DomainStartEndE-ValueType
transmembrane domain 13 35 N/A INTRINSIC
Pfam:Sugar_tr 99 527 1.4e-26 PFAM
Pfam:MFS_1 140 375 1.1e-15 PFAM
Meta Mutation Damage Score 0.4721 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.3%
  • 20x: 97.4%
Validation Efficiency 98% (55/56)
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3425401B19Rik T A 14: 32,661,279 M910L probably benign Het
Abca9 T A 11: 110,134,254 I988F probably damaging Het
Adgra2 A T 8: 27,118,850 S92C probably damaging Het
Apon A G 10: 128,254,354 probably benign Het
Arap3 G A 18: 37,997,031 R26* probably null Het
BC049730 A T 7: 24,714,110 I184F probably damaging Het
Btnl6 T G 17: 34,508,369 I396L probably benign Het
Catsper3 G T 13: 55,786,426 Q53H probably damaging Het
Cep164 T G 9: 45,779,783 E372A probably damaging Het
Cln3 A T 7: 126,575,035 C339S probably null Het
Cntnap2 G A 6: 46,856,180 D776N probably benign Het
Cttnbp2nl A G 3: 105,005,636 F311L probably benign Het
Daam2 C T 17: 49,463,936 A918T probably damaging Het
Dst T C 1: 34,307,468 V7353A possibly damaging Het
Enpp5 G A 17: 44,085,264 G356S probably damaging Het
Fanca A T 8: 123,305,867 probably null Het
Filip1 G T 9: 79,820,531 Q269K possibly damaging Het
Fut9 G A 4: 25,620,328 S162L probably damaging Het
Gtf2ird1 A T 5: 134,404,690 H294Q probably benign Het
Gucy1a1 A G 3: 82,109,006 I225T probably benign Het
H2-DMb1 T A 17: 34,155,602 N75K probably benign Het
Helz2 C T 2: 181,233,467 E1745K probably damaging Het
Hes1 A G 16: 30,065,606 M6V possibly damaging Het
Hydin A T 8: 110,312,224 H198L possibly damaging Het
Iars T C 13: 49,701,895 L266P probably damaging Het
Ifna11 A G 4: 88,820,149 E64G probably damaging Het
Inpp5d T A 1: 87,699,675 L566Q probably damaging Het
Kcnh3 T C 15: 99,227,941 S160P probably benign Het
Lama5 T C 2: 180,196,533 T850A probably damaging Het
Lgi3 A G 14: 70,531,170 T36A possibly damaging Het
Lrp2 T C 2: 69,495,784 S1810G probably benign Het
Msln T A 17: 25,751,141 D280V probably benign Het
Myh4 A T 11: 67,255,837 I1513F probably damaging Het
Ncf2 A T 1: 152,830,422 M262L probably benign Het
Neb G T 2: 52,185,299 A218D probably damaging Het
Notch4 C A 17: 34,573,814 Q640K probably null Het
Olfr1303 T C 2: 111,814,619 I36V probably benign Het
Olfr231 A T 1: 174,117,296 F240Y probably damaging Het
Olfr603 A T 7: 103,383,897 V35D possibly damaging Het
Pear1 G T 3: 87,754,199 H562N probably benign Het
Poli C A 18: 70,530,001 probably benign Het
Ppp3r2 A G 4: 49,681,767 I61T possibly damaging Het
Rfc5 T C 5: 117,385,398 T112A probably benign Het
Serhl A G 15: 83,101,622 T5A probably benign Het
Shank3 T C 15: 89,521,375 probably null Het
Slc2a12 C T 10: 22,694,030 T540I possibly damaging Het
Slurp2 T C 15: 74,746,675 M1V probably null Het
St3gal1 A G 15: 67,111,346 V187A possibly damaging Het
Tln2 C T 9: 67,278,129 A700T probably benign Het
Ttn C T 2: 76,917,848 V4286I probably benign Het
Ube2u A G 4: 100,532,144 K214R possibly damaging Het
Vmn1r46 A G 6: 89,976,445 H92R probably damaging Het
Wdr90 A G 17: 25,848,530 I1486T probably damaging Het
Zc3h11a A T 1: 133,637,454 S236T possibly damaging Het
Zfp318 A G 17: 46,411,006 K1312E probably damaging Het
Zfp930 A G 8: 69,228,631 Y326C probably damaging Het
Zfp972 G T 2: 177,921,795 D8E probably damaging Het
Other mutations in Slc22a28
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00155:Slc22a28 APN 19 8130203 missense possibly damaging 0.89
IGL00515:Slc22a28 APN 19 8117064 missense probably benign 0.34
IGL01025:Slc22a28 APN 19 8116908 splice site probably benign
IGL02697:Slc22a28 APN 19 8117127 missense probably benign 0.06
PIT4378001:Slc22a28 UTSW 19 8071914 missense probably damaging 0.96
R0744:Slc22a28 UTSW 19 8116833 missense possibly damaging 0.94
R0836:Slc22a28 UTSW 19 8116833 missense possibly damaging 0.94
R1398:Slc22a28 UTSW 19 8130202 nonsense probably null
R1456:Slc22a28 UTSW 19 8071858 missense possibly damaging 0.50
R1603:Slc22a28 UTSW 19 8063309 missense probably damaging 1.00
R1993:Slc22a28 UTSW 19 8117124 missense possibly damaging 0.79
R2254:Slc22a28 UTSW 19 8064493 missense probably benign
R2262:Slc22a28 UTSW 19 8071208 missense probably benign 0.00
R4078:Slc22a28 UTSW 19 8101413 missense probably benign 0.15
R4165:Slc22a28 UTSW 19 8063408 missense possibly damaging 0.95
R4612:Slc22a28 UTSW 19 8101406 missense probably damaging 1.00
R4947:Slc22a28 UTSW 19 8131452 missense probably benign 0.03
R5573:Slc22a28 UTSW 19 8071097 missense possibly damaging 0.50
R5611:Slc22a28 UTSW 19 8063333 missense probably damaging 1.00
R5621:Slc22a28 UTSW 19 8071011 missense probably benign 0.00
R5671:Slc22a28 UTSW 19 8131431 missense probably damaging 1.00
R6063:Slc22a28 UTSW 19 8117022 missense probably benign 0.01
R6358:Slc22a28 UTSW 19 8071888 missense probably damaging 0.99
R6680:Slc22a28 UTSW 19 8101393 missense probably benign 0.07
R6767:Slc22a28 UTSW 19 8117045 missense probably damaging 1.00
R6865:Slc22a28 UTSW 19 8064491 nonsense probably null
R6947:Slc22a28 UTSW 19 8064510 missense possibly damaging 0.58
R7049:Slc22a28 UTSW 19 8071905 missense probably benign
R7269:Slc22a28 UTSW 19 8117127 missense probably benign 0.06
R7484:Slc22a28 UTSW 19 8071127 missense probably benign
R7823:Slc22a28 UTSW 19 8064525 missense probably benign 0.38
R7856:Slc22a28 UTSW 19 8063333 missense probably damaging 1.00
Z1088:Slc22a28 UTSW 19 8062398 missense probably damaging 0.96
Z1176:Slc22a28 UTSW 19 8062383 nonsense probably null
Predicted Primers PCR Primer
(F):5'- TCTTGGGCACTAACTCATACAC -3'
(R):5'- CTAGGTATGCATTTCAGAAGTGCAG -3'

Sequencing Primer
(F):5'- CTTGGGCACTAACTCATACACATGTG -3'
(R):5'- CAGTGCATTATGTGGCTGAATCATTC -3'
Posted On2018-05-04