Incidental Mutation 'R6386:Cop1'
ID515588
Institutional Source Beutler Lab
Gene Symbol Cop1
Ensembl Gene ENSMUSG00000040782
Gene NameCOP1, E3 ubiquitin ligase
SynonymsCop1
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.495) question?
Stock #R6386 (G1)
Quality Score225.009
Status Not validated
Chromosome1
Chromosomal Location159232320-159347640 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 159289031 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Threonine at position 125 (I125T)
Ref Sequence ENSEMBL: ENSMUSP00000141200 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000076894] [ENSMUST00000192215] [ENSMUST00000195044]
Predicted Effect probably damaging
Transcript: ENSMUST00000076894
AA Change: I425T

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000076160
Gene: ENSMUSG00000040782
AA Change: I425T

DomainStartEndE-ValueType
low complexity region 2 87 N/A INTRINSIC
low complexity region 98 112 N/A INTRINSIC
RING 138 175 3.69e-8 SMART
coiled coil region 235 305 N/A INTRINSIC
WD40 412 451 1.72e0 SMART
WD40 462 501 3.4e-2 SMART
WD40 504 544 3.42e-7 SMART
WD40 547 586 6.79e-2 SMART
WD40 590 628 1.9e-5 SMART
WD40 631 670 4.46e-1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000192215
SMART Domains Protein: ENSMUSP00000141285
Gene: ENSMUSG00000040782

DomainStartEndE-ValueType
low complexity region 1 17 N/A INTRINSIC
low complexity region 28 42 N/A INTRINSIC
RING 68 105 1.8e-10 SMART
coiled coil region 161 231 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000192762
AA Change: I215T
Predicted Effect probably damaging
Transcript: ENSMUST00000195044
AA Change: I125T

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000141200
Gene: ENSMUSG00000040782
AA Change: I125T

DomainStartEndE-ValueType
WD40 112 151 1.1e-2 SMART
WD40 162 201 2.1e-4 SMART
Meta Mutation Damage Score 0.376 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.1%
  • 20x: 96.6%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a conditional allele activated in prostate epithelial cells exhibit prostate gland hyperplasia and prostate intraepithelial neoplasia due to increased cell proliferation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ak6 TGACGA TGA 13: 100,655,803 probably benign Het
Arap2 A T 5: 62,604,522 N1620K possibly damaging Het
Atf6b T C 17: 34,651,851 S396P probably damaging Het
Cc2d1a A G 8: 84,138,537 M469T probably damaging Het
Ceacam3 A G 7: 17,158,219 N296D probably benign Het
Cep57l1 A T 10: 41,743,132 S80T probably damaging Het
Clip4 C A 17: 71,834,194 Y514* probably null Het
Cstf1 T C 2: 172,377,896 V309A probably damaging Het
Cyp4a29 T G 4: 115,247,075 probably null Het
F830045P16Rik G A 2: 129,472,818 H180Y probably damaging Het
Foxp4 T C 17: 47,878,462 K237E unknown Het
Fstl5 A T 3: 76,322,066 H58L probably benign Het
Gje1 A G 10: 14,716,621 F139S probably damaging Het
Gpatch1 T C 7: 35,291,840 D593G probably damaging Het
Inpp5d T A 1: 87,699,675 L566Q probably damaging Het
Mtch2 A G 2: 90,849,395 T38A probably benign Het
Mvb12b A T 2: 33,827,742 I129N probably damaging Het
Npffr2 T C 5: 89,582,697 V162A probably benign Het
Olfr1424 A T 19: 12,059,556 N65K probably damaging Het
Olfr485 A T 7: 108,159,202 Y224N probably damaging Het
Pkhd1 G A 1: 20,551,020 R805C probably damaging Het
Ppp4r4 T C 12: 103,593,105 L406P probably damaging Het
Prl3d2 A G 13: 27,127,303 D186G probably damaging Het
Rfc5 T C 5: 117,385,398 T112A probably benign Het
Rnf148 A G 6: 23,654,484 L171P probably damaging Het
Rps24 G A 14: 24,492,048 G71S possibly damaging Het
Slco2a1 G A 9: 103,076,988 V453I probably benign Het
Spidr T C 16: 15,968,560 K440E probably benign Het
Syndig1 C A 2: 149,899,576 N27K probably damaging Het
Tmem62 C T 2: 120,999,114 T316I probably benign Het
Tpgs2 A T 18: 25,139,024 I258N possibly damaging Het
Vmn2r78 A T 7: 86,922,337 R452* probably null Het
Wasf3 A T 5: 146,453,417 I124F possibly damaging Het
Wbp11 T C 6: 136,820,525 T299A probably benign Het
Wdr25 T C 12: 109,025,065 S41P probably damaging Het
Zfp874b T C 13: 67,474,843 D116G possibly damaging Het
Other mutations in Cop1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02572:Cop1 APN 1 159308878 unclassified probably benign
IGL02945:Cop1 APN 1 159306689 missense probably benign 0.20
IGL03059:Cop1 APN 1 159306709 missense probably damaging 1.00
R0032:Cop1 UTSW 1 159325036 critical splice donor site probably null
R0179:Cop1 UTSW 1 159250066 missense probably benign 0.20
R0846:Cop1 UTSW 1 159319816 missense probably benign 0.26
R0988:Cop1 UTSW 1 159232847 missense possibly damaging 0.76
R0988:Cop1 UTSW 1 159244672 missense probably damaging 1.00
R2296:Cop1 UTSW 1 159244650 missense possibly damaging 0.92
R2297:Cop1 UTSW 1 159252554 missense possibly damaging 0.53
R2504:Cop1 UTSW 1 159232805 missense probably damaging 0.98
R2974:Cop1 UTSW 1 159324929 missense possibly damaging 0.95
R4889:Cop1 UTSW 1 159284589 missense probably damaging 1.00
R4965:Cop1 UTSW 1 159239597 missense probably damaging 0.99
R4981:Cop1 UTSW 1 159325068 unclassified probably benign
R5124:Cop1 UTSW 1 159278112 missense probably damaging 0.96
R5263:Cop1 UTSW 1 159324937 missense probably damaging 1.00
R5268:Cop1 UTSW 1 159327164 missense probably damaging 1.00
R5470:Cop1 UTSW 1 159266860 intron probably benign
R5595:Cop1 UTSW 1 159250073 missense probably benign 0.00
R5919:Cop1 UTSW 1 159319724 missense probably damaging 1.00
R6865:Cop1 UTSW 1 159308954 missense probably damaging 1.00
R6995:Cop1 UTSW 1 159306584 missense probably damaging 1.00
R7056:Cop1 UTSW 1 159250077 missense probably damaging 0.98
R7146:Cop1 UTSW 1 159244352 intron probably null
R7242:Cop1 UTSW 1 159284548 missense probably benign 0.00
R7309:Cop1 UTSW 1 159306625 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- GATGTTTCAGTGAATTCCTAGACC -3'
(R):5'- AGAAACTGCCACCTCCTGTC -3'

Sequencing Primer
(F):5'- TCACCTAATTAATTTGAGCATACTGC -3'
(R):5'- ACCTCCTGTCAGATGGATGC -3'
Posted On2018-05-04