Incidental Mutation 'R6386:Mvb12b'
ID515589
Institutional Source Beutler Lab
Gene Symbol Mvb12b
Ensembl Gene ENSMUSG00000038740
Gene Namemultivesicular body subunit 12B
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.770) question?
Stock #R6386 (G1)
Quality Score225.009
Status Not validated
Chromosome2
Chromosomal Location33729953-33887946 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 33827742 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Asparagine at position 129 (I129N)
Ref Sequence ENSEMBL: ENSMUSP00000115744 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000041555] [ENSMUST00000148660]
Predicted Effect probably damaging
Transcript: ENSMUST00000041555
AA Change: I158N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000048901
Gene: ENSMUSG00000038740
AA Change: I158N

DomainStartEndE-ValueType
low complexity region 13 22 N/A INTRINSIC
Pfam:DUF2464 46 297 1.7e-87 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000148660
AA Change: I129N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000115744
Gene: ENSMUSG00000038740
AA Change: I129N

DomainStartEndE-ValueType
Pfam:DUF2464 17 189 1.4e-72 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000192765
Meta Mutation Damage Score 0.8979 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.1%
  • 20x: 96.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a component of the ESCRT-I complex, a heterotetramer, which mediates the sorting of ubiquitinated cargo protein from the plasma membrane to the endosomal vesicle. ESCRT-I complex plays an essential role in HIV budding and endosomal protein sorting. Depletion and overexpression of this and related protein (MVB12A) inhibit HIV-1 infectivity and induce unusual viral assembly defects, indicating a role for MVB12 subunits in regulating ESCRT-mediated virus budding. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Aug 2011]
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ak6 TGACGA TGA 13: 100,655,803 probably benign Het
Arap2 A T 5: 62,604,522 N1620K possibly damaging Het
Atf6b T C 17: 34,651,851 S396P probably damaging Het
Cc2d1a A G 8: 84,138,537 M469T probably damaging Het
Ceacam3 A G 7: 17,158,219 N296D probably benign Het
Cep57l1 A T 10: 41,743,132 S80T probably damaging Het
Clip4 C A 17: 71,834,194 Y514* probably null Het
Cop1 T C 1: 159,289,031 I125T probably damaging Het
Cstf1 T C 2: 172,377,896 V309A probably damaging Het
Cyp4a29 T G 4: 115,247,075 probably null Het
F830045P16Rik G A 2: 129,472,818 H180Y probably damaging Het
Foxp4 T C 17: 47,878,462 K237E unknown Het
Fstl5 A T 3: 76,322,066 H58L probably benign Het
Gje1 A G 10: 14,716,621 F139S probably damaging Het
Gpatch1 T C 7: 35,291,840 D593G probably damaging Het
Inpp5d T A 1: 87,699,675 L566Q probably damaging Het
Mtch2 A G 2: 90,849,395 T38A probably benign Het
Npffr2 T C 5: 89,582,697 V162A probably benign Het
Olfr1424 A T 19: 12,059,556 N65K probably damaging Het
Olfr485 A T 7: 108,159,202 Y224N probably damaging Het
Pkhd1 G A 1: 20,551,020 R805C probably damaging Het
Ppp4r4 T C 12: 103,593,105 L406P probably damaging Het
Prl3d2 A G 13: 27,127,303 D186G probably damaging Het
Rfc5 T C 5: 117,385,398 T112A probably benign Het
Rnf148 A G 6: 23,654,484 L171P probably damaging Het
Rps24 G A 14: 24,492,048 G71S possibly damaging Het
Slco2a1 G A 9: 103,076,988 V453I probably benign Het
Spidr T C 16: 15,968,560 K440E probably benign Het
Syndig1 C A 2: 149,899,576 N27K probably damaging Het
Tmem62 C T 2: 120,999,114 T316I probably benign Het
Tpgs2 A T 18: 25,139,024 I258N possibly damaging Het
Vmn2r78 A T 7: 86,922,337 R452* probably null Het
Wasf3 A T 5: 146,453,417 I124F possibly damaging Het
Wbp11 T C 6: 136,820,525 T299A probably benign Het
Wdr25 T C 12: 109,025,065 S41P probably damaging Het
Zfp874b T C 13: 67,474,843 D116G possibly damaging Het
Other mutations in Mvb12b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02429:Mvb12b APN 2 33827788 missense probably damaging 1.00
IGL02493:Mvb12b APN 2 33840209 missense probably benign 0.05
R1845:Mvb12b UTSW 2 33840157 critical splice donor site probably null
R2225:Mvb12b UTSW 2 33840199 missense possibly damaging 0.88
R4545:Mvb12b UTSW 2 33827700 missense possibly damaging 0.63
R5631:Mvb12b UTSW 2 33827703 missense probably damaging 1.00
R5733:Mvb12b UTSW 2 33827716 missense probably benign 0.02
R6043:Mvb12b UTSW 2 33874390 missense probably damaging 1.00
R6563:Mvb12b UTSW 2 33825116 missense probably benign 0.04
R8160:Mvb12b UTSW 2 33840222 missense probably benign 0.44
Z1176:Mvb12b UTSW 2 33874370 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CAGCTGCAGTGTAAGCTGAC -3'
(R):5'- TAGTCCCTCTGCCAAGTGAC -3'

Sequencing Primer
(F):5'- CAGTGTAAGCTGACGTAGGCTG -3'
(R):5'- TCTGCCAAGTGACAGGGTG -3'
Posted On2018-05-04