Incidental Mutation 'R6386:Tmem62'
ID515591
Institutional Source Beutler Lab
Gene Symbol Tmem62
Ensembl Gene ENSMUSG00000054484
Gene Nametransmembrane protein 62
SynonymsB830009D23Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.306) question?
Stock #R6386 (G1)
Quality Score225.009
Status Not validated
Chromosome2
Chromosomal Location120977017-121007852 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 120999114 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Isoleucine at position 316 (T316I)
Ref Sequence ENSEMBL: ENSMUSP00000106314 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000067582] [ENSMUST00000110686] [ENSMUST00000139428]
Predicted Effect probably benign
Transcript: ENSMUST00000067582
AA Change: T446I

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000064310
Gene: ENSMUSG00000054484
AA Change: T446I

DomainStartEndE-ValueType
signal peptide 1 29 N/A INTRINSIC
Pfam:Metallophos 56 261 7.3e-11 PFAM
transmembrane domain 430 452 N/A INTRINSIC
transmembrane domain 479 501 N/A INTRINSIC
transmembrane domain 530 552 N/A INTRINSIC
transmembrane domain 573 595 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000083949
Predicted Effect probably benign
Transcript: ENSMUST00000110686
AA Change: T316I

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000106314
Gene: ENSMUSG00000054484
AA Change: T316I

DomainStartEndE-ValueType
transmembrane domain 300 322 N/A INTRINSIC
transmembrane domain 349 371 N/A INTRINSIC
transmembrane domain 400 422 N/A INTRINSIC
transmembrane domain 443 465 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135599
Predicted Effect probably benign
Transcript: ENSMUST00000139428
SMART Domains Protein: ENSMUSP00000118808
Gene: ENSMUSG00000054484

DomainStartEndE-ValueType
signal peptide 1 29 N/A INTRINSIC
SCOP:d1utea_ 59 274 9e-9 SMART
low complexity region 308 327 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.1%
  • 20x: 96.6%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ak6 TGACGA TGA 13: 100,655,803 probably benign Het
Arap2 A T 5: 62,604,522 N1620K possibly damaging Het
Atf6b T C 17: 34,651,851 S396P probably damaging Het
Cc2d1a A G 8: 84,138,537 M469T probably damaging Het
Ceacam3 A G 7: 17,158,219 N296D probably benign Het
Cep57l1 A T 10: 41,743,132 S80T probably damaging Het
Clip4 C A 17: 71,834,194 Y514* probably null Het
Cop1 T C 1: 159,289,031 I125T probably damaging Het
Cstf1 T C 2: 172,377,896 V309A probably damaging Het
Cyp4a29 T G 4: 115,247,075 probably null Het
F830045P16Rik G A 2: 129,472,818 H180Y probably damaging Het
Foxp4 T C 17: 47,878,462 K237E unknown Het
Fstl5 A T 3: 76,322,066 H58L probably benign Het
Gje1 A G 10: 14,716,621 F139S probably damaging Het
Gpatch1 T C 7: 35,291,840 D593G probably damaging Het
Inpp5d T A 1: 87,699,675 L566Q probably damaging Het
Mtch2 A G 2: 90,849,395 T38A probably benign Het
Mvb12b A T 2: 33,827,742 I129N probably damaging Het
Npffr2 T C 5: 89,582,697 V162A probably benign Het
Olfr1424 A T 19: 12,059,556 N65K probably damaging Het
Olfr485 A T 7: 108,159,202 Y224N probably damaging Het
Pkhd1 G A 1: 20,551,020 R805C probably damaging Het
Ppp4r4 T C 12: 103,593,105 L406P probably damaging Het
Prl3d2 A G 13: 27,127,303 D186G probably damaging Het
Rfc5 T C 5: 117,385,398 T112A probably benign Het
Rnf148 A G 6: 23,654,484 L171P probably damaging Het
Rps24 G A 14: 24,492,048 G71S possibly damaging Het
Slco2a1 G A 9: 103,076,988 V453I probably benign Het
Spidr T C 16: 15,968,560 K440E probably benign Het
Syndig1 C A 2: 149,899,576 N27K probably damaging Het
Tpgs2 A T 18: 25,139,024 I258N possibly damaging Het
Vmn2r78 A T 7: 86,922,337 R452* probably null Het
Wasf3 A T 5: 146,453,417 I124F possibly damaging Het
Wbp11 T C 6: 136,820,525 T299A probably benign Het
Wdr25 T C 12: 109,025,065 S41P probably damaging Het
Zfp874b T C 13: 67,474,843 D116G possibly damaging Het
Other mutations in Tmem62
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00417:Tmem62 APN 2 121006964 unclassified probably null
IGL01011:Tmem62 APN 2 120979219 missense possibly damaging 0.48
IGL02125:Tmem62 APN 2 120996512 missense probably benign 0.01
IGL02430:Tmem62 APN 2 120986662 missense probably damaging 1.00
R0031:Tmem62 UTSW 2 120999113 missense probably benign 0.00
R0535:Tmem62 UTSW 2 121002596 missense possibly damaging 0.88
R1597:Tmem62 UTSW 2 120984362 missense probably benign 0.01
R1656:Tmem62 UTSW 2 121007002 missense probably benign 0.36
R1682:Tmem62 UTSW 2 121007057 missense probably benign 0.32
R1702:Tmem62 UTSW 2 120979227 missense probably damaging 1.00
R1755:Tmem62 UTSW 2 120984477 critical splice donor site probably null
R1886:Tmem62 UTSW 2 120986670 missense probably damaging 0.99
R1943:Tmem62 UTSW 2 120986626 missense probably benign 0.10
R2151:Tmem62 UTSW 2 120986862 missense probably damaging 1.00
R2419:Tmem62 UTSW 2 121007105 missense probably damaging 0.98
R3034:Tmem62 UTSW 2 120979124 splice site probably benign
R3782:Tmem62 UTSW 2 120977467 missense probably damaging 1.00
R4326:Tmem62 UTSW 2 120980510 missense probably damaging 1.00
R4328:Tmem62 UTSW 2 120980510 missense probably damaging 1.00
R4620:Tmem62 UTSW 2 120996364 intron probably benign
R5168:Tmem62 UTSW 2 120993607 missense probably benign 0.16
R5625:Tmem62 UTSW 2 120990393 missense probably damaging 1.00
R6057:Tmem62 UTSW 2 120977462 missense probably damaging 0.98
R7038:Tmem62 UTSW 2 120993577 missense possibly damaging 0.87
R7182:Tmem62 UTSW 2 121004743 missense probably benign 0.08
R7569:Tmem62 UTSW 2 121006930 missense probably benign
R7607:Tmem62 UTSW 2 120996440 missense probably benign 0.00
R7849:Tmem62 UTSW 2 120984372 missense probably benign 0.01
R7932:Tmem62 UTSW 2 120984372 missense probably benign 0.01
X0052:Tmem62 UTSW 2 120993528 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CAGCCAAGCATTTAAACAGGAAGTG -3'
(R):5'- TTATTGCCATGCAGTAGAAGGG -3'

Sequencing Primer
(F):5'- acagaggacgaagaAGAC -3'
(R):5'- CCATGCAGTAGAAGGGTGAAAAG -3'
Posted On2018-05-04