Incidental Mutation 'R6386:Cstf1'
ID515594
Institutional Source Beutler Lab
Gene Symbol Cstf1
Ensembl Gene ENSMUSG00000027498
Gene Namecleavage stimulation factor, 3' pre-RNA, subunit 1
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.963) question?
Stock #R6386 (G1)
Quality Score225.009
Status Not validated
Chromosome2
Chromosomal Location172370681-172382448 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 172377896 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 309 (V309A)
Ref Sequence ENSEMBL: ENSMUSP00000112076 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000116375] [ENSMUST00000151511]
Predicted Effect probably damaging
Transcript: ENSMUST00000116375
AA Change: V309A

PolyPhen 2 Score 0.966 (Sensitivity: 0.77; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000112076
Gene: ENSMUSG00000027498
AA Change: V309A

DomainStartEndE-ValueType
Pfam:CSTF1_dimer 6 62 5.4e-28 PFAM
WD40 97 136 2.61e-3 SMART
WD40 162 201 3.29e-9 SMART
WD40 206 245 6.88e0 SMART
WD40 248 290 9.02e-7 SMART
WD40 293 334 1.44e-5 SMART
Blast:WD40 337 382 8e-9 BLAST
WD40 385 425 2.49e-1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000151511
SMART Domains Protein: ENSMUSP00000121178
Gene: ENSMUSG00000027498

DomainStartEndE-ValueType
PDB:2XZ2|A 8 59 2e-7 PDB
WD40 97 136 2.61e-3 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.1%
  • 20x: 96.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes one of three subunits which combine to form cleavage stimulation factor (CSTF). CSTF is involved in the polyadenylation and 3'end cleavage of pre-mRNAs. Similar to mammalian G protein beta subunits, this protein contains transducin-like repeats. Several transcript variants with different 5' UTR, but encoding the same protein, have been found for this gene. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ak6 TGACGA TGA 13: 100,655,803 probably benign Het
Arap2 A T 5: 62,604,522 N1620K possibly damaging Het
Atf6b T C 17: 34,651,851 S396P probably damaging Het
Cc2d1a A G 8: 84,138,537 M469T probably damaging Het
Ceacam3 A G 7: 17,158,219 N296D probably benign Het
Cep57l1 A T 10: 41,743,132 S80T probably damaging Het
Clip4 C A 17: 71,834,194 Y514* probably null Het
Cop1 T C 1: 159,289,031 I125T probably damaging Het
Cyp4a29 T G 4: 115,247,075 probably null Het
F830045P16Rik G A 2: 129,472,818 H180Y probably damaging Het
Foxp4 T C 17: 47,878,462 K237E unknown Het
Fstl5 A T 3: 76,322,066 H58L probably benign Het
Gje1 A G 10: 14,716,621 F139S probably damaging Het
Gpatch1 T C 7: 35,291,840 D593G probably damaging Het
Inpp5d T A 1: 87,699,675 L566Q probably damaging Het
Mtch2 A G 2: 90,849,395 T38A probably benign Het
Mvb12b A T 2: 33,827,742 I129N probably damaging Het
Npffr2 T C 5: 89,582,697 V162A probably benign Het
Olfr1424 A T 19: 12,059,556 N65K probably damaging Het
Olfr485 A T 7: 108,159,202 Y224N probably damaging Het
Pkhd1 G A 1: 20,551,020 R805C probably damaging Het
Ppp4r4 T C 12: 103,593,105 L406P probably damaging Het
Prl3d2 A G 13: 27,127,303 D186G probably damaging Het
Rfc5 T C 5: 117,385,398 T112A probably benign Het
Rnf148 A G 6: 23,654,484 L171P probably damaging Het
Rps24 G A 14: 24,492,048 G71S possibly damaging Het
Slco2a1 G A 9: 103,076,988 V453I probably benign Het
Spidr T C 16: 15,968,560 K440E probably benign Het
Syndig1 C A 2: 149,899,576 N27K probably damaging Het
Tmem62 C T 2: 120,999,114 T316I probably benign Het
Tpgs2 A T 18: 25,139,024 I258N possibly damaging Het
Vmn2r78 A T 7: 86,922,337 R452* probably null Het
Wasf3 A T 5: 146,453,417 I124F possibly damaging Het
Wbp11 T C 6: 136,820,525 T299A probably benign Het
Wdr25 T C 12: 109,025,065 S41P probably damaging Het
Zfp874b T C 13: 67,474,843 D116G possibly damaging Het
Other mutations in Cstf1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01658:Cstf1 APN 2 172373073 missense probably benign 0.32
IGL02306:Cstf1 APN 2 172372971 missense probably benign 0.02
IGL02553:Cstf1 APN 2 172377854 missense probably benign 0.19
IGL02756:Cstf1 APN 2 172375875 missense probably damaging 1.00
R0066:Cstf1 UTSW 2 172373056 missense probably benign 0.04
R0066:Cstf1 UTSW 2 172373056 missense probably benign 0.04
R0244:Cstf1 UTSW 2 172377710 missense possibly damaging 0.87
R1448:Cstf1 UTSW 2 172375875 missense probably damaging 1.00
R1770:Cstf1 UTSW 2 172373063 missense possibly damaging 0.59
R2055:Cstf1 UTSW 2 172380483 missense probably benign 0.00
R2146:Cstf1 UTSW 2 172375763 missense probably damaging 1.00
R3119:Cstf1 UTSW 2 172373070 missense possibly damaging 0.75
R3701:Cstf1 UTSW 2 172380392 missense probably benign 0.00
R4816:Cstf1 UTSW 2 172372985 missense probably damaging 1.00
R4893:Cstf1 UTSW 2 172380524 missense probably damaging 1.00
R4991:Cstf1 UTSW 2 172377800 missense probably damaging 1.00
R4992:Cstf1 UTSW 2 172377800 missense probably damaging 1.00
R5743:Cstf1 UTSW 2 172377833 missense probably damaging 1.00
R7314:Cstf1 UTSW 2 172373034 missense probably damaging 1.00
R7843:Cstf1 UTSW 2 172378000 missense probably damaging 1.00
R7926:Cstf1 UTSW 2 172378000 missense probably damaging 1.00
X0026:Cstf1 UTSW 2 172375860 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CTTCTGGAGACTTCATCCTGGTG -3'
(R):5'- AGTGCCTCATTCCTGCTCAG -3'

Sequencing Primer
(F):5'- TGTATGACATCAACACCTTCCAGTG -3'
(R):5'- TGCTCAGCACTGCGATC -3'
Posted On2018-05-04