Incidental Mutation 'R6386:Cyp4a29'
ID515596
Institutional Source Beutler Lab
Gene Symbol Cyp4a29
Ensembl Gene ENSMUSG00000083138
Gene Namecytochrome P450, family 4, subfamily a, polypeptide 29
SynonymsCyp4a29-ps
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.080) question?
Stock #R6386 (G1)
Quality Score225.009
Status Not validated
Chromosome4
Chromosomal Location115242084-115254557 bp(+) (GRCm38)
Type of Mutationcritical splice donor site (2 bp from exon)
DNA Base Change (assembly) T to G at 115247075 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000139717 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000118278] [ENSMUST00000118278]
Predicted Effect probably null
Transcript: ENSMUST00000118278
SMART Domains Protein: ENSMUSP00000139717
Gene: ENSMUSG00000083138

DomainStartEndE-ValueType
transmembrane domain 9 31 N/A INTRINSIC
Pfam:p450 51 504 1.1e-127 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000118278
SMART Domains Protein: ENSMUSP00000139717
Gene: ENSMUSG00000083138

DomainStartEndE-ValueType
transmembrane domain 9 31 N/A INTRINSIC
Pfam:p450 51 504 1.1e-127 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.1%
  • 20x: 96.6%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ak6 TGACGA TGA 13: 100,655,803 probably benign Het
Arap2 A T 5: 62,604,522 N1620K possibly damaging Het
Atf6b T C 17: 34,651,851 S396P probably damaging Het
Cc2d1a A G 8: 84,138,537 M469T probably damaging Het
Ceacam3 A G 7: 17,158,219 N296D probably benign Het
Cep57l1 A T 10: 41,743,132 S80T probably damaging Het
Clip4 C A 17: 71,834,194 Y514* probably null Het
Cop1 T C 1: 159,289,031 I125T probably damaging Het
Cstf1 T C 2: 172,377,896 V309A probably damaging Het
F830045P16Rik G A 2: 129,472,818 H180Y probably damaging Het
Foxp4 T C 17: 47,878,462 K237E unknown Het
Fstl5 A T 3: 76,322,066 H58L probably benign Het
Gje1 A G 10: 14,716,621 F139S probably damaging Het
Gpatch1 T C 7: 35,291,840 D593G probably damaging Het
Inpp5d T A 1: 87,699,675 L566Q probably damaging Het
Mtch2 A G 2: 90,849,395 T38A probably benign Het
Mvb12b A T 2: 33,827,742 I129N probably damaging Het
Npffr2 T C 5: 89,582,697 V162A probably benign Het
Olfr1424 A T 19: 12,059,556 N65K probably damaging Het
Olfr485 A T 7: 108,159,202 Y224N probably damaging Het
Pkhd1 G A 1: 20,551,020 R805C probably damaging Het
Ppp4r4 T C 12: 103,593,105 L406P probably damaging Het
Prl3d2 A G 13: 27,127,303 D186G probably damaging Het
Rfc5 T C 5: 117,385,398 T112A probably benign Het
Rnf148 A G 6: 23,654,484 L171P probably damaging Het
Rps24 G A 14: 24,492,048 G71S possibly damaging Het
Slco2a1 G A 9: 103,076,988 V453I probably benign Het
Spidr T C 16: 15,968,560 K440E probably benign Het
Syndig1 C A 2: 149,899,576 N27K probably damaging Het
Tmem62 C T 2: 120,999,114 T316I probably benign Het
Tpgs2 A T 18: 25,139,024 I258N possibly damaging Het
Vmn2r78 A T 7: 86,922,337 R452* probably null Het
Wasf3 A T 5: 146,453,417 I124F possibly damaging Het
Wbp11 T C 6: 136,820,525 T299A probably benign Het
Wdr25 T C 12: 109,025,065 S41P probably damaging Het
Zfp874b T C 13: 67,474,843 D116G possibly damaging Het
Other mutations in Cyp4a29
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02687:Cyp4a29 APN 4 115251200 missense probably damaging 0.99
IGL03224:Cyp4a29 APN 4 115247050 missense probably damaging 0.97
IGL03271:Cyp4a29 APN 4 115254508 missense probably damaging 1.00
IGL03387:Cyp4a29 APN 4 115251171 missense possibly damaging 0.70
R0304:Cyp4a29 UTSW 4 115252932 splice site probably benign
R2656:Cyp4a29 UTSW 4 115249724 missense possibly damaging 0.95
R4012:Cyp4a29 UTSW 4 115248510 missense probably benign
R4834:Cyp4a29 UTSW 4 115249670 missense probably benign 0.00
R4856:Cyp4a29 UTSW 4 115252881 missense probably benign
R4886:Cyp4a29 UTSW 4 115252881 missense probably benign
R4939:Cyp4a29 UTSW 4 115247676 critical splice donor site probably null
R4967:Cyp4a29 UTSW 4 115246999 missense probably benign 0.00
R5071:Cyp4a29 UTSW 4 115247663 missense probably benign 0.00
R5072:Cyp4a29 UTSW 4 115247663 missense probably benign 0.00
R5073:Cyp4a29 UTSW 4 115247663 missense probably benign 0.00
R5620:Cyp4a29 UTSW 4 115250891 missense probably benign 0.12
R5818:Cyp4a29 UTSW 4 115247032 missense possibly damaging 0.89
R6219:Cyp4a29 UTSW 4 115249730 missense probably damaging 0.99
R6318:Cyp4a29 UTSW 4 115250199 missense probably benign 0.00
R6456:Cyp4a29 UTSW 4 115251184 missense probably benign 0.30
R7393:Cyp4a29 UTSW 4 115242196 missense probably damaging 1.00
R7443:Cyp4a29 UTSW 4 115248559 missense probably damaging 1.00
R7719:Cyp4a29 UTSW 4 115250940 missense possibly damaging 0.65
R7831:Cyp4a29 UTSW 4 115250170 missense probably benign 0.00
R7914:Cyp4a29 UTSW 4 115250170 missense probably benign 0.00
U24488:Cyp4a29 UTSW 4 115251007 missense possibly damaging 0.95
Z1088:Cyp4a29 UTSW 4 115248496 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TACTTCCAGCCTGTTCAAGATG -3'
(R):5'- CTGTTAAAGGGATGTCTCAAACCC -3'

Sequencing Primer
(F):5'- TCCAGCCTGTTCAAGATGATATC -3'
(R):5'- CGACAAATTTTCTAGCTAGTCAACTG -3'
Posted On2018-05-04