Incidental Mutation 'R6386:Npffr2'
ID515598
Institutional Source Beutler Lab
Gene Symbol Npffr2
Ensembl Gene ENSMUSG00000035528
Gene Nameneuropeptide FF receptor 2
SynonymsNPFF2, Gpr74
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6386 (G1)
Quality Score225.009
Status Not validated
Chromosome5
Chromosomal Location89527429-89583740 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 89582697 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 162 (V162A)
Ref Sequence ENSEMBL: ENSMUSP00000040033 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000048557]
Predicted Effect probably benign
Transcript: ENSMUST00000048557
AA Change: V162A

PolyPhen 2 Score 0.024 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000040033
Gene: ENSMUSG00000035528
AA Change: V162A

DomainStartEndE-ValueType
Pfam:7tm_4 52 349 3.8e-8 PFAM
Pfam:7TM_GPCR_Srsx 56 347 3.7e-11 PFAM
Pfam:7tm_1 62 332 4.2e-57 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.1%
  • 20x: 96.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of a subfamily of G-protein-coupled neuropeptide receptors. This protein is activated by the neuropeptides A-18-amide (NPAF) and F-8-amide (NPFF) and may function in pain modulation and regulation of the opioid system. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jan 2009]
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ak6 TGACGA TGA 13: 100,655,803 probably benign Het
Arap2 A T 5: 62,604,522 N1620K possibly damaging Het
Atf6b T C 17: 34,651,851 S396P probably damaging Het
Cc2d1a A G 8: 84,138,537 M469T probably damaging Het
Ceacam3 A G 7: 17,158,219 N296D probably benign Het
Cep57l1 A T 10: 41,743,132 S80T probably damaging Het
Clip4 C A 17: 71,834,194 Y514* probably null Het
Cop1 T C 1: 159,289,031 I125T probably damaging Het
Cstf1 T C 2: 172,377,896 V309A probably damaging Het
Cyp4a29 T G 4: 115,247,075 probably null Het
F830045P16Rik G A 2: 129,472,818 H180Y probably damaging Het
Foxp4 T C 17: 47,878,462 K237E unknown Het
Fstl5 A T 3: 76,322,066 H58L probably benign Het
Gje1 A G 10: 14,716,621 F139S probably damaging Het
Gpatch1 T C 7: 35,291,840 D593G probably damaging Het
Inpp5d T A 1: 87,699,675 L566Q probably damaging Het
Mtch2 A G 2: 90,849,395 T38A probably benign Het
Mvb12b A T 2: 33,827,742 I129N probably damaging Het
Olfr1424 A T 19: 12,059,556 N65K probably damaging Het
Olfr485 A T 7: 108,159,202 Y224N probably damaging Het
Pkhd1 G A 1: 20,551,020 R805C probably damaging Het
Ppp4r4 T C 12: 103,593,105 L406P probably damaging Het
Prl3d2 A G 13: 27,127,303 D186G probably damaging Het
Rfc5 T C 5: 117,385,398 T112A probably benign Het
Rnf148 A G 6: 23,654,484 L171P probably damaging Het
Rps24 G A 14: 24,492,048 G71S possibly damaging Het
Slco2a1 G A 9: 103,076,988 V453I probably benign Het
Spidr T C 16: 15,968,560 K440E probably benign Het
Syndig1 C A 2: 149,899,576 N27K probably damaging Het
Tmem62 C T 2: 120,999,114 T316I probably benign Het
Tpgs2 A T 18: 25,139,024 I258N possibly damaging Het
Vmn2r78 A T 7: 86,922,337 R452* probably null Het
Wasf3 A T 5: 146,453,417 I124F possibly damaging Het
Wbp11 T C 6: 136,820,525 T299A probably benign Het
Wdr25 T C 12: 109,025,065 S41P probably damaging Het
Zfp874b T C 13: 67,474,843 D116G possibly damaging Het
Other mutations in Npffr2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01989:Npffr2 APN 5 89582972 missense probably benign
IGL02308:Npffr2 APN 5 89583451 missense probably benign 0.00
IGL02455:Npffr2 APN 5 89568135 missense probably damaging 1.00
IGL03288:Npffr2 APN 5 89583161 missense probably damaging 1.00
R0309:Npffr2 UTSW 5 89583347 missense probably benign 0.00
R0389:Npffr2 UTSW 5 89582754 missense probably benign 0.15
R1552:Npffr2 UTSW 5 89583116 missense possibly damaging 0.45
R1736:Npffr2 UTSW 5 89568066 missense probably damaging 1.00
R2015:Npffr2 UTSW 5 89582892 missense probably damaging 0.99
R2127:Npffr2 UTSW 5 89568065 missense probably damaging 1.00
R2129:Npffr2 UTSW 5 89568065 missense probably damaging 1.00
R2429:Npffr2 UTSW 5 89583147 missense probably damaging 1.00
R4272:Npffr2 UTSW 5 89568023 missense probably damaging 1.00
R4740:Npffr2 UTSW 5 89583020 nonsense probably null
R5023:Npffr2 UTSW 5 89582687 missense probably benign 0.07
R6546:Npffr2 UTSW 5 89583012 missense probably damaging 1.00
R7735:Npffr2 UTSW 5 89583314 missense probably benign
R7998:Npffr2 UTSW 5 89583290 missense probably damaging 0.99
R8043:Npffr2 UTSW 5 89582654 missense probably benign 0.24
X0039:Npffr2 UTSW 5 89583287 missense probably benign 0.16
X0063:Npffr2 UTSW 5 89567985 missense probably benign 0.42
Predicted Primers PCR Primer
(F):5'- GAGCCATACTGCATTACCACAG -3'
(R):5'- GCCCCAATCCTTGCATACATG -3'

Sequencing Primer
(F):5'- ACCACAGGTGCTAACTTTCTGTG -3'
(R):5'- ATAGCACCGTGGTATAGATCCTC -3'
Posted On2018-05-04