Incidental Mutation 'R6386:Rfc5'
ID515599
Institutional Source Beutler Lab
Gene Symbol Rfc5
Ensembl Gene ENSMUSG00000029363
Gene Namereplication factor C (activator 1) 5
Synonyms36.5kDa, 2610209F07Rik, 2610020K06Rik, 36kDa, Recc5
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.962) question?
Stock #R6386 (G1)
Quality Score225.009
Status Not validated
Chromosome5
Chromosomal Location117378103-117389047 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 117385398 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 112 (T112A)
Ref Sequence ENSEMBL: ENSMUSP00000083652 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000086461] [ENSMUST00000111953]
Predicted Effect probably benign
Transcript: ENSMUST00000086461
AA Change: T112A

PolyPhen 2 Score 0.029 (Sensitivity: 0.95; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000083652
Gene: ENSMUSG00000029363
AA Change: T112A

DomainStartEndE-ValueType
low complexity region 3 17 N/A INTRINSIC
AAA 51 179 4.16e-14 SMART
Pfam:Rep_fac_C 241 327 1.8e-26 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000111953
SMART Domains Protein: ENSMUSP00000107584
Gene: ENSMUSG00000029363

DomainStartEndE-ValueType
Pfam:DUF815 3 105 4.8e-8 PFAM
Pfam:RuvB_N 10 100 3e-8 PFAM
Pfam:Rad17 14 110 9.5e-13 PFAM
Pfam:AAA_19 43 94 1.4e-8 PFAM
Pfam:AAA 55 103 2.2e-7 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126262
Predicted Effect noncoding transcript
Transcript: ENSMUST00000129369
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140833
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150962
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156391
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.1%
  • 20x: 96.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes the smallest subunit of the replication factor C complex, which consists of five distinct subunits (140, 40, 38, 37, and 36 kDa) and is required for DNA replication. This subunit interacts with the C-terminal region of proliferating cell nuclear antigen and is required to open and load proliferating cell nuclear antigen onto DNA during S phase. It is a member of the AAA+ (ATPases associated with various cellular activities) ATPase family and forms a core complex with the 38 and 40 kDa subunits that possesses DNA-dependent ATPase activity. A related pseudogene has been identified on chromosome 9. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Nov 2016]
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ak6 TGACGA TGA 13: 100,655,803 probably benign Het
Arap2 A T 5: 62,604,522 N1620K possibly damaging Het
Atf6b T C 17: 34,651,851 S396P probably damaging Het
Cc2d1a A G 8: 84,138,537 M469T probably damaging Het
Ceacam3 A G 7: 17,158,219 N296D probably benign Het
Cep57l1 A T 10: 41,743,132 S80T probably damaging Het
Clip4 C A 17: 71,834,194 Y514* probably null Het
Cop1 T C 1: 159,289,031 I125T probably damaging Het
Cstf1 T C 2: 172,377,896 V309A probably damaging Het
Cyp4a29 T G 4: 115,247,075 probably null Het
F830045P16Rik G A 2: 129,472,818 H180Y probably damaging Het
Foxp4 T C 17: 47,878,462 K237E unknown Het
Fstl5 A T 3: 76,322,066 H58L probably benign Het
Gje1 A G 10: 14,716,621 F139S probably damaging Het
Gpatch1 T C 7: 35,291,840 D593G probably damaging Het
Inpp5d T A 1: 87,699,675 L566Q probably damaging Het
Mtch2 A G 2: 90,849,395 T38A probably benign Het
Mvb12b A T 2: 33,827,742 I129N probably damaging Het
Npffr2 T C 5: 89,582,697 V162A probably benign Het
Olfr1424 A T 19: 12,059,556 N65K probably damaging Het
Olfr485 A T 7: 108,159,202 Y224N probably damaging Het
Pkhd1 G A 1: 20,551,020 R805C probably damaging Het
Ppp4r4 T C 12: 103,593,105 L406P probably damaging Het
Prl3d2 A G 13: 27,127,303 D186G probably damaging Het
Rnf148 A G 6: 23,654,484 L171P probably damaging Het
Rps24 G A 14: 24,492,048 G71S possibly damaging Het
Slco2a1 G A 9: 103,076,988 V453I probably benign Het
Spidr T C 16: 15,968,560 K440E probably benign Het
Syndig1 C A 2: 149,899,576 N27K probably damaging Het
Tmem62 C T 2: 120,999,114 T316I probably benign Het
Tpgs2 A T 18: 25,139,024 I258N possibly damaging Het
Vmn2r78 A T 7: 86,922,337 R452* probably null Het
Wasf3 A T 5: 146,453,417 I124F possibly damaging Het
Wbp11 T C 6: 136,820,525 T299A probably benign Het
Wdr25 T C 12: 109,025,065 S41P probably damaging Het
Zfp874b T C 13: 67,474,843 D116G possibly damaging Het
Other mutations in Rfc5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02544:Rfc5 APN 5 117386866 splice site probably benign
R2078:Rfc5 UTSW 5 117380803 missense probably benign 0.01
R2431:Rfc5 UTSW 5 117385458 missense probably damaging 1.00
R4787:Rfc5 UTSW 5 117382420 missense probably benign 0.00
R4890:Rfc5 UTSW 5 117386820 missense probably damaging 1.00
R6385:Rfc5 UTSW 5 117385398 missense probably benign 0.03
R6963:Rfc5 UTSW 5 117387866 splice site probably null
Predicted Primers PCR Primer
(F):5'- CAGTACTGGATGTGACTCCC -3'
(R):5'- AGCTGTCATTAGACCTGAATGG -3'

Sequencing Primer
(F):5'- AAGGCTCATGGAGTCCTCTATC -3'
(R):5'- CATTAGACCTGAATGGCTGGC -3'
Posted On2018-05-04