Incidental Mutation 'R6386:Rnf148'
ID515601
Institutional Source Beutler Lab
Gene Symbol Rnf148
Ensembl Gene ENSMUSG00000078179
Gene Namering finger protein 148
SynonymsGreul3, 4933432M07Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.074) question?
Stock #R6386 (G1)
Quality Score225.009
Status Not validated
Chromosome6
Chromosomal Location23653898-23655136 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 23654484 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Proline at position 171 (L171P)
Ref Sequence ENSEMBL: ENSMUSP00000100592 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000018122] [ENSMUST00000063548] [ENSMUST00000069074] [ENSMUST00000104979] [ENSMUST00000115354] [ENSMUST00000115356] [ENSMUST00000115358] [ENSMUST00000115361] [ENSMUST00000142913] [ENSMUST00000163871] [ENSMUST00000166458]
Predicted Effect probably benign
Transcript: ENSMUST00000018122
SMART Domains Protein: ENSMUSP00000018122
Gene: ENSMUSG00000017978

DomainStartEndE-ValueType
low complexity region 5 21 N/A INTRINSIC
low complexity region 31 65 N/A INTRINSIC
low complexity region 114 126 N/A INTRINSIC
coiled coil region 265 285 N/A INTRINSIC
C2 369 467 1.51e-1 SMART
PH 492 596 2.94e-11 SMART
DUF1041 801 902 1.14e-52 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000063548
SMART Domains Protein: ENSMUSP00000066906
Gene: ENSMUSG00000051956

DomainStartEndE-ValueType
Pfam:PA 94 162 3.6e-11 PFAM
RING 213 253 6.43e-8 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000069074
SMART Domains Protein: ENSMUSP00000064876
Gene: ENSMUSG00000017978

DomainStartEndE-ValueType
low complexity region 5 21 N/A INTRINSIC
low complexity region 31 65 N/A INTRINSIC
low complexity region 114 126 N/A INTRINSIC
coiled coil region 265 285 N/A INTRINSIC
C2 369 467 1.51e-1 SMART
PH 492 596 2.94e-11 SMART
DUF1041 801 895 5.54e-51 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000104979
AA Change: L171P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000100592
Gene: ENSMUSG00000078179
AA Change: L171P

DomainStartEndE-ValueType
low complexity region 25 43 N/A INTRINSIC
Pfam:PA 82 178 1e-13 PFAM
RING 269 309 1.82e-7 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000115354
SMART Domains Protein: ENSMUSP00000111011
Gene: ENSMUSG00000051956

DomainStartEndE-ValueType
Pfam:PA 70 165 1.9e-13 PFAM
RING 256 296 6.43e-8 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000115356
SMART Domains Protein: ENSMUSP00000111013
Gene: ENSMUSG00000017978

DomainStartEndE-ValueType
low complexity region 5 21 N/A INTRINSIC
low complexity region 31 65 N/A INTRINSIC
low complexity region 114 126 N/A INTRINSIC
coiled coil region 265 285 N/A INTRINSIC
C2 369 467 1.51e-1 SMART
PH 492 596 2.94e-11 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000115358
SMART Domains Protein: ENSMUSP00000111015
Gene: ENSMUSG00000017978

DomainStartEndE-ValueType
low complexity region 5 21 N/A INTRINSIC
low complexity region 31 65 N/A INTRINSIC
low complexity region 114 126 N/A INTRINSIC
coiled coil region 265 285 N/A INTRINSIC
C2 369 467 1.51e-1 SMART
PH 492 596 2.94e-11 SMART
DUF1041 801 902 1.14e-52 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000115361
SMART Domains Protein: ENSMUSP00000111018
Gene: ENSMUSG00000017978

DomainStartEndE-ValueType
low complexity region 5 21 N/A INTRINSIC
low complexity region 31 65 N/A INTRINSIC
low complexity region 114 126 N/A INTRINSIC
coiled coil region 265 285 N/A INTRINSIC
C2 369 467 1.51e-1 SMART
PH 492 596 2.94e-11 SMART
DUF1041 801 892 1.9e-49 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000136279
Predicted Effect probably benign
Transcript: ENSMUST00000142913
SMART Domains Protein: ENSMUSP00000138167
Gene: ENSMUSG00000017978

DomainStartEndE-ValueType
low complexity region 5 21 N/A INTRINSIC
low complexity region 22 39 N/A INTRINSIC
low complexity region 85 97 N/A INTRINSIC
coiled coil region 236 256 N/A INTRINSIC
C2 340 438 1.51e-1 SMART
PH 463 567 2.94e-11 SMART
DUF1041 772 873 1.14e-52 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000163871
SMART Domains Protein: ENSMUSP00000128905
Gene: ENSMUSG00000017978

DomainStartEndE-ValueType
low complexity region 5 21 N/A INTRINSIC
low complexity region 31 65 N/A INTRINSIC
low complexity region 114 126 N/A INTRINSIC
coiled coil region 265 285 N/A INTRINSIC
C2 369 467 1.51e-1 SMART
PH 492 596 2.94e-11 SMART
DUF1041 801 902 7.2e-50 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000166458
SMART Domains Protein: ENSMUSP00000125972
Gene: ENSMUSG00000017978

DomainStartEndE-ValueType
low complexity region 5 21 N/A INTRINSIC
low complexity region 85 97 N/A INTRINSIC
coiled coil region 236 256 N/A INTRINSIC
C2 340 438 1.51e-1 SMART
PH 463 567 2.94e-11 SMART
DUF1041 772 873 1.05e-51 SMART
Meta Mutation Damage Score 0.1965 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.1%
  • 20x: 96.6%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ak6 TGACGA TGA 13: 100,655,803 probably benign Het
Arap2 A T 5: 62,604,522 N1620K possibly damaging Het
Atf6b T C 17: 34,651,851 S396P probably damaging Het
Cc2d1a A G 8: 84,138,537 M469T probably damaging Het
Ceacam3 A G 7: 17,158,219 N296D probably benign Het
Cep57l1 A T 10: 41,743,132 S80T probably damaging Het
Clip4 C A 17: 71,834,194 Y514* probably null Het
Cop1 T C 1: 159,289,031 I125T probably damaging Het
Cstf1 T C 2: 172,377,896 V309A probably damaging Het
Cyp4a29 T G 4: 115,247,075 probably null Het
F830045P16Rik G A 2: 129,472,818 H180Y probably damaging Het
Foxp4 T C 17: 47,878,462 K237E unknown Het
Fstl5 A T 3: 76,322,066 H58L probably benign Het
Gje1 A G 10: 14,716,621 F139S probably damaging Het
Gpatch1 T C 7: 35,291,840 D593G probably damaging Het
Inpp5d T A 1: 87,699,675 L566Q probably damaging Het
Mtch2 A G 2: 90,849,395 T38A probably benign Het
Mvb12b A T 2: 33,827,742 I129N probably damaging Het
Npffr2 T C 5: 89,582,697 V162A probably benign Het
Olfr1424 A T 19: 12,059,556 N65K probably damaging Het
Olfr485 A T 7: 108,159,202 Y224N probably damaging Het
Pkhd1 G A 1: 20,551,020 R805C probably damaging Het
Ppp4r4 T C 12: 103,593,105 L406P probably damaging Het
Prl3d2 A G 13: 27,127,303 D186G probably damaging Het
Rfc5 T C 5: 117,385,398 T112A probably benign Het
Rps24 G A 14: 24,492,048 G71S possibly damaging Het
Slco2a1 G A 9: 103,076,988 V453I probably benign Het
Spidr T C 16: 15,968,560 K440E probably benign Het
Syndig1 C A 2: 149,899,576 N27K probably damaging Het
Tmem62 C T 2: 120,999,114 T316I probably benign Het
Tpgs2 A T 18: 25,139,024 I258N possibly damaging Het
Vmn2r78 A T 7: 86,922,337 R452* probably null Het
Wasf3 A T 5: 146,453,417 I124F possibly damaging Het
Wbp11 T C 6: 136,820,525 T299A probably benign Het
Wdr25 T C 12: 109,025,065 S41P probably damaging Het
Zfp874b T C 13: 67,474,843 D116G possibly damaging Het
Other mutations in Rnf148
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01727:Rnf148 APN 6 23655002 intron probably benign
IGL02307:Rnf148 APN 6 23654891 missense probably benign 0.34
IGL02347:Rnf148 APN 6 23654730 missense probably benign 0.01
IGL02366:Rnf148 APN 6 23654059 missense probably benign 0.12
IGL02598:Rnf148 APN 6 23654457 missense probably damaging 1.00
R0427:Rnf148 UTSW 6 23654073 missense probably damaging 0.99
R0458:Rnf148 UTSW 6 23654257 missense probably benign 0.37
R0465:Rnf148 UTSW 6 23654685 missense probably benign 0.02
R0514:Rnf148 UTSW 6 23654793 missense possibly damaging 0.95
R0538:Rnf148 UTSW 6 23654238 missense probably damaging 1.00
R0658:Rnf148 UTSW 6 23654457 missense probably damaging 1.00
R1831:Rnf148 UTSW 6 23654773 missense probably damaging 1.00
R2238:Rnf148 UTSW 6 23654346 missense probably benign 0.41
R3741:Rnf148 UTSW 6 23654065 missense possibly damaging 0.78
R4933:Rnf148 UTSW 6 23654340 missense probably benign 0.02
R5188:Rnf148 UTSW 6 23654140 missense probably damaging 1.00
R7231:Rnf148 UTSW 6 23654891 missense probably benign 0.34
R7526:Rnf148 UTSW 6 23654284 nonsense probably null
R7613:Rnf148 UTSW 6 23654980 missense probably benign 0.01
R8025:Rnf148 UTSW 6 23654197 missense possibly damaging 0.55
Predicted Primers PCR Primer
(F):5'- AATTGGACACTCGGGGTCTC -3'
(R):5'- TCAGAATGCTTGCAGTCCGC -3'

Sequencing Primer
(F):5'- GGTCTCCAGGCACAGTATAGG -3'
(R):5'- TTGCAGTCCGCTGACCAAC -3'
Posted On2018-05-04