Incidental Mutation 'R6386:Wbp11'
ID515602
Institutional Source Beutler Lab
Gene Symbol Wbp11
Ensembl Gene ENSMUSG00000030216
Gene NameWW domain binding protein 11
SynonymsNpwbp, SIPP1, 2510026P17Rik, D6Wsu113e
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.947) question?
Stock #R6386 (G1)
Quality Score225.009
Status Not validated
Chromosome6
Chromosomal Location136813654-136828233 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 136820525 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 299 (T299A)
Ref Sequence ENSEMBL: ENSMUSP00000112213 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000116514] [ENSMUST00000146348] [ENSMUST00000204272]
Predicted Effect probably benign
Transcript: ENSMUST00000116514
AA Change: T299A

PolyPhen 2 Score 0.364 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000112213
Gene: ENSMUSG00000030216
AA Change: T299A

DomainStartEndE-ValueType
Pfam:Wbp11 12 94 1e-26 PFAM
low complexity region 191 209 N/A INTRINSIC
low complexity region 263 284 N/A INTRINSIC
low complexity region 344 367 N/A INTRINSIC
low complexity region 380 532 N/A INTRINSIC
low complexity region 549 565 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000129078
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141598
Predicted Effect probably benign
Transcript: ENSMUST00000146348
Predicted Effect noncoding transcript
Transcript: ENSMUST00000151333
Predicted Effect probably benign
Transcript: ENSMUST00000204129
Predicted Effect silent
Transcript: ENSMUST00000204272
SMART Domains Protein: ENSMUSP00000145501
Gene: ENSMUSG00000030216

DomainStartEndE-ValueType
Pfam:Wbp11 12 94 3.8e-24 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.1%
  • 20x: 96.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a nuclear protein, which colocalizes with mRNA splicing factors and intermediate filament-containing perinuclear networks. This protein has 95% amino acid sequence identity to the mouse Wbp11 protein. It contains two proline-rich regions that bind to the WW domain of Npw38, a nuclear protein, and thus this protein is also called Npw38-binding protein NpwBP. The Npw38-NpwBP complex may function as a component of an mRNA factory in the nucleus. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ak6 TGACGA TGA 13: 100,655,803 probably benign Het
Arap2 A T 5: 62,604,522 N1620K possibly damaging Het
Atf6b T C 17: 34,651,851 S396P probably damaging Het
Cc2d1a A G 8: 84,138,537 M469T probably damaging Het
Ceacam3 A G 7: 17,158,219 N296D probably benign Het
Cep57l1 A T 10: 41,743,132 S80T probably damaging Het
Clip4 C A 17: 71,834,194 Y514* probably null Het
Cop1 T C 1: 159,289,031 I125T probably damaging Het
Cstf1 T C 2: 172,377,896 V309A probably damaging Het
Cyp4a29 T G 4: 115,247,075 probably null Het
F830045P16Rik G A 2: 129,472,818 H180Y probably damaging Het
Foxp4 T C 17: 47,878,462 K237E unknown Het
Fstl5 A T 3: 76,322,066 H58L probably benign Het
Gje1 A G 10: 14,716,621 F139S probably damaging Het
Gpatch1 T C 7: 35,291,840 D593G probably damaging Het
Inpp5d T A 1: 87,699,675 L566Q probably damaging Het
Mtch2 A G 2: 90,849,395 T38A probably benign Het
Mvb12b A T 2: 33,827,742 I129N probably damaging Het
Npffr2 T C 5: 89,582,697 V162A probably benign Het
Olfr1424 A T 19: 12,059,556 N65K probably damaging Het
Olfr485 A T 7: 108,159,202 Y224N probably damaging Het
Pkhd1 G A 1: 20,551,020 R805C probably damaging Het
Ppp4r4 T C 12: 103,593,105 L406P probably damaging Het
Prl3d2 A G 13: 27,127,303 D186G probably damaging Het
Rfc5 T C 5: 117,385,398 T112A probably benign Het
Rnf148 A G 6: 23,654,484 L171P probably damaging Het
Rps24 G A 14: 24,492,048 G71S possibly damaging Het
Slco2a1 G A 9: 103,076,988 V453I probably benign Het
Spidr T C 16: 15,968,560 K440E probably benign Het
Syndig1 C A 2: 149,899,576 N27K probably damaging Het
Tmem62 C T 2: 120,999,114 T316I probably benign Het
Tpgs2 A T 18: 25,139,024 I258N possibly damaging Het
Vmn2r78 A T 7: 86,922,337 R452* probably null Het
Wasf3 A T 5: 146,453,417 I124F possibly damaging Het
Wdr25 T C 12: 109,025,065 S41P probably damaging Het
Zfp874b T C 13: 67,474,843 D116G possibly damaging Het
Other mutations in Wbp11
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00324:Wbp11 APN 6 136821670 intron probably benign
IGL01408:Wbp11 APN 6 136814614 unclassified probably benign
R0639:Wbp11 UTSW 6 136816110 unclassified probably benign
R0685:Wbp11 UTSW 6 136814638 unclassified probably benign
R1264:Wbp11 UTSW 6 136814515 unclassified probably benign
R1987:Wbp11 UTSW 6 136820585 missense probably damaging 0.99
R2362:Wbp11 UTSW 6 136824332 missense probably damaging 1.00
R4646:Wbp11 UTSW 6 136821191 missense probably benign 0.10
R5682:Wbp11 UTSW 6 136814254 unclassified probably benign
R6045:Wbp11 UTSW 6 136821535 missense probably damaging 0.99
R6567:Wbp11 UTSW 6 136820539 missense probably benign 0.02
R7132:Wbp11 UTSW 6 136821542 missense probably benign 0.24
Predicted Primers PCR Primer
(F):5'- TGGATCGGGAAAACCAACTG -3'
(R):5'- TTGGATACCAGAGGGCCAAC -3'

Sequencing Primer
(F):5'- GGGACTGCCACATAGATGCTCTAG -3'
(R):5'- AACCGTGTCATGTGACTCTCGTG -3'
Posted On2018-05-04