Incidental Mutation 'R6386:Ceacam3'
ID515603
Institutional Source Beutler Lab
Gene Symbol Ceacam3
Ensembl Gene ENSMUSG00000053228
Gene Namecarcinoembryonic antigen-related cell adhesion molecule 3
SynonymsEG384557, cea12, Psg24
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6386 (G1)
Quality Score225.009
Status Not validated
Chromosome7
Chromosomal Location17150282-17164253 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 17158219 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Aspartic acid at position 296 (N296D)
Ref Sequence ENSEMBL: ENSMUSP00000104131 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000108491]
Predicted Effect probably benign
Transcript: ENSMUST00000108491
AA Change: N296D

PolyPhen 2 Score 0.218 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000104131
Gene: ENSMUSG00000053228
AA Change: N296D

DomainStartEndE-ValueType
IG 40 141 2.83e-3 SMART
IG 160 261 6.31e-1 SMART
IG 280 379 8.01e-3 SMART
IG 398 497 2.08e-1 SMART
IG 514 613 1.26e0 SMART
IGc2 631 695 7.64e-9 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.1%
  • 20x: 96.6%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ak6 TGACGA TGA 13: 100,655,803 probably benign Het
Arap2 A T 5: 62,604,522 N1620K possibly damaging Het
Atf6b T C 17: 34,651,851 S396P probably damaging Het
Cc2d1a A G 8: 84,138,537 M469T probably damaging Het
Cep57l1 A T 10: 41,743,132 S80T probably damaging Het
Clip4 C A 17: 71,834,194 Y514* probably null Het
Cop1 T C 1: 159,289,031 I125T probably damaging Het
Cstf1 T C 2: 172,377,896 V309A probably damaging Het
Cyp4a29 T G 4: 115,247,075 probably null Het
F830045P16Rik G A 2: 129,472,818 H180Y probably damaging Het
Foxp4 T C 17: 47,878,462 K237E unknown Het
Fstl5 A T 3: 76,322,066 H58L probably benign Het
Gje1 A G 10: 14,716,621 F139S probably damaging Het
Gpatch1 T C 7: 35,291,840 D593G probably damaging Het
Inpp5d T A 1: 87,699,675 L566Q probably damaging Het
Mtch2 A G 2: 90,849,395 T38A probably benign Het
Mvb12b A T 2: 33,827,742 I129N probably damaging Het
Npffr2 T C 5: 89,582,697 V162A probably benign Het
Olfr1424 A T 19: 12,059,556 N65K probably damaging Het
Olfr485 A T 7: 108,159,202 Y224N probably damaging Het
Pkhd1 G A 1: 20,551,020 R805C probably damaging Het
Ppp4r4 T C 12: 103,593,105 L406P probably damaging Het
Prl3d2 A G 13: 27,127,303 D186G probably damaging Het
Rfc5 T C 5: 117,385,398 T112A probably benign Het
Rnf148 A G 6: 23,654,484 L171P probably damaging Het
Rps24 G A 14: 24,492,048 G71S possibly damaging Het
Slco2a1 G A 9: 103,076,988 V453I probably benign Het
Spidr T C 16: 15,968,560 K440E probably benign Het
Syndig1 C A 2: 149,899,576 N27K probably damaging Het
Tmem62 C T 2: 120,999,114 T316I probably benign Het
Tpgs2 A T 18: 25,139,024 I258N possibly damaging Het
Vmn2r78 A T 7: 86,922,337 R452* probably null Het
Wasf3 A T 5: 146,453,417 I124F possibly damaging Het
Wbp11 T C 6: 136,820,525 T299A probably benign Het
Wdr25 T C 12: 109,025,065 S41P probably damaging Het
Zfp874b T C 13: 67,474,843 D116G possibly damaging Het
Other mutations in Ceacam3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01161:Ceacam3 APN 7 17151857 missense probably benign 0.03
IGL01510:Ceacam3 APN 7 17159842 missense probably benign 0.00
IGL01830:Ceacam3 APN 7 17155000 missense possibly damaging 0.79
IGL02155:Ceacam3 APN 7 17162981 missense possibly damaging 0.58
IGL02281:Ceacam3 APN 7 17161731 missense probably benign 0.43
IGL02301:Ceacam3 APN 7 17163101 missense probably damaging 1.00
IGL02320:Ceacam3 APN 7 17161940 missense probably benign 0.43
IGL02514:Ceacam3 APN 7 17162981 missense possibly damaging 0.58
IGL02929:Ceacam3 APN 7 17158190 missense probably damaging 1.00
IGL03143:Ceacam3 APN 7 17158120 nonsense probably null
IGL03269:Ceacam3 APN 7 17161842 missense probably damaging 0.99
R0408:Ceacam3 UTSW 7 17151883 critical splice donor site probably benign
R0591:Ceacam3 UTSW 7 17151883 critical splice donor site probably null
R1274:Ceacam3 UTSW 7 17163139 missense probably damaging 0.98
R1376:Ceacam3 UTSW 7 17163163 missense probably damaging 1.00
R1376:Ceacam3 UTSW 7 17163163 missense probably damaging 1.00
R1490:Ceacam3 UTSW 7 17163146 missense probably damaging 1.00
R1635:Ceacam3 UTSW 7 17159977 missense probably damaging 1.00
R1769:Ceacam3 UTSW 7 17158376 missense probably damaging 1.00
R2345:Ceacam3 UTSW 7 17155000 missense possibly damaging 0.79
R2367:Ceacam3 UTSW 7 17151888 splice site probably null
R2403:Ceacam3 UTSW 7 17161854 missense probably damaging 1.00
R4030:Ceacam3 UTSW 7 17158342 missense probably benign 0.43
R4240:Ceacam3 UTSW 7 17160024 missense possibly damaging 0.95
R5305:Ceacam3 UTSW 7 17151576 missense probably damaging 1.00
R5314:Ceacam3 UTSW 7 17158371 missense possibly damaging 0.94
R5433:Ceacam3 UTSW 7 17159883 missense possibly damaging 0.48
R5538:Ceacam3 UTSW 7 17158421 missense probably damaging 1.00
R5638:Ceacam3 UTSW 7 17159935 missense probably damaging 0.98
R5787:Ceacam3 UTSW 7 17155046 missense possibly damaging 0.80
R5891:Ceacam3 UTSW 7 17151793 missense probably damaging 1.00
R5918:Ceacam3 UTSW 7 17159745 missense probably damaging 0.99
R6074:Ceacam3 UTSW 7 17151559 missense probably benign 0.05
R6439:Ceacam3 UTSW 7 17158328 missense possibly damaging 0.59
R6455:Ceacam3 UTSW 7 17161938 missense possibly damaging 0.81
R7150:Ceacam3 UTSW 7 17151562 missense
R7196:Ceacam3 UTSW 7 17154956 missense
R7201:Ceacam3 UTSW 7 17158238 nonsense probably null
R7731:Ceacam3 UTSW 7 17158350 missense
R7833:Ceacam3 UTSW 7 17159853 missense
R7916:Ceacam3 UTSW 7 17159853 missense
Predicted Primers PCR Primer
(F):5'- CTTAGTCAAATACAAGCGTCCC -3'
(R):5'- GTTGCACATGCGCTACTTCAG -3'

Sequencing Primer
(F):5'- AATACAAGCGTCCCCATATTAATG -3'
(R):5'- AGGTGTAGAATCCGGCATCATTCC -3'
Posted On2018-05-04