Incidental Mutation 'R6386:Gpatch1'
ID515604
Institutional Source Beutler Lab
Gene Symbol Gpatch1
Ensembl Gene ENSMUSG00000063808
Gene NameG patch domain containing 1
SynonymsGpatc1, 1300003A17Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6386 (G1)
Quality Score225.009
Status Not validated
Chromosome7
Chromosomal Location35276536-35318440 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 35291840 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 593 (D593G)
Ref Sequence ENSEMBL: ENSMUSP00000117475 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000079693] [ENSMUST00000131143] [ENSMUST00000131213]
Predicted Effect probably damaging
Transcript: ENSMUST00000079693
AA Change: D593G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000078632
Gene: ENSMUSG00000063808
AA Change: D593G

DomainStartEndE-ValueType
Pfam:DUF1604 31 116 2.1e-39 PFAM
G_patch 150 191 4.72e-1 SMART
low complexity region 200 209 N/A INTRINSIC
low complexity region 456 478 N/A INTRINSIC
low complexity region 543 555 N/A INTRINSIC
low complexity region 651 665 N/A INTRINSIC
low complexity region 759 780 N/A INTRINSIC
low complexity region 803 816 N/A INTRINSIC
low complexity region 847 897 N/A INTRINSIC
low complexity region 899 909 N/A INTRINSIC
low complexity region 918 929 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000131143
SMART Domains Protein: ENSMUSP00000121711
Gene: ENSMUSG00000063808

DomainStartEndE-ValueType
Pfam:DUF1604 29 98 2.2e-37 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000131213
AA Change: D593G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000117475
Gene: ENSMUSG00000063808
AA Change: D593G

DomainStartEndE-ValueType
Pfam:DUF1604 31 116 7.9e-40 PFAM
G_patch 150 191 4.72e-1 SMART
low complexity region 200 209 N/A INTRINSIC
low complexity region 456 478 N/A INTRINSIC
low complexity region 543 555 N/A INTRINSIC
low complexity region 651 665 N/A INTRINSIC
low complexity region 759 780 N/A INTRINSIC
low complexity region 803 816 N/A INTRINSIC
low complexity region 849 881 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.1%
  • 20x: 96.6%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ak6 TGACGA TGA 13: 100,655,803 probably benign Het
Arap2 A T 5: 62,604,522 N1620K possibly damaging Het
Atf6b T C 17: 34,651,851 S396P probably damaging Het
Cc2d1a A G 8: 84,138,537 M469T probably damaging Het
Ceacam3 A G 7: 17,158,219 N296D probably benign Het
Cep57l1 A T 10: 41,743,132 S80T probably damaging Het
Clip4 C A 17: 71,834,194 Y514* probably null Het
Cop1 T C 1: 159,289,031 I125T probably damaging Het
Cstf1 T C 2: 172,377,896 V309A probably damaging Het
Cyp4a29 T G 4: 115,247,075 probably null Het
F830045P16Rik G A 2: 129,472,818 H180Y probably damaging Het
Foxp4 T C 17: 47,878,462 K237E unknown Het
Fstl5 A T 3: 76,322,066 H58L probably benign Het
Gje1 A G 10: 14,716,621 F139S probably damaging Het
Inpp5d T A 1: 87,699,675 L566Q probably damaging Het
Mtch2 A G 2: 90,849,395 T38A probably benign Het
Mvb12b A T 2: 33,827,742 I129N probably damaging Het
Npffr2 T C 5: 89,582,697 V162A probably benign Het
Olfr1424 A T 19: 12,059,556 N65K probably damaging Het
Olfr485 A T 7: 108,159,202 Y224N probably damaging Het
Pkhd1 G A 1: 20,551,020 R805C probably damaging Het
Ppp4r4 T C 12: 103,593,105 L406P probably damaging Het
Prl3d2 A G 13: 27,127,303 D186G probably damaging Het
Rfc5 T C 5: 117,385,398 T112A probably benign Het
Rnf148 A G 6: 23,654,484 L171P probably damaging Het
Rps24 G A 14: 24,492,048 G71S possibly damaging Het
Slco2a1 G A 9: 103,076,988 V453I probably benign Het
Spidr T C 16: 15,968,560 K440E probably benign Het
Syndig1 C A 2: 149,899,576 N27K probably damaging Het
Tmem62 C T 2: 120,999,114 T316I probably benign Het
Tpgs2 A T 18: 25,139,024 I258N possibly damaging Het
Vmn2r78 A T 7: 86,922,337 R452* probably null Het
Wasf3 A T 5: 146,453,417 I124F possibly damaging Het
Wbp11 T C 6: 136,820,525 T299A probably benign Het
Wdr25 T C 12: 109,025,065 S41P probably damaging Het
Zfp874b T C 13: 67,474,843 D116G possibly damaging Het
Other mutations in Gpatch1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00818:Gpatch1 APN 7 35276813 critical splice acceptor site probably null
IGL01143:Gpatch1 APN 7 35301572 splice site probably benign
IGL01523:Gpatch1 APN 7 35308338 missense probably null 1.00
IGL01862:Gpatch1 APN 7 35295278 missense probably benign
IGL02349:Gpatch1 APN 7 35307255 missense probably damaging 1.00
IGL02792:Gpatch1 APN 7 35301593 missense probably damaging 0.96
IGL02926:Gpatch1 APN 7 35308269 missense probably damaging 1.00
IGL03099:Gpatch1 APN 7 35297523 missense possibly damaging 0.87
IGL03107:Gpatch1 APN 7 35303317 missense probably benign 0.35
IGL03324:Gpatch1 APN 7 35299280 missense probably damaging 0.96
IGL03324:Gpatch1 APN 7 35293695 missense possibly damaging 0.81
R0066:Gpatch1 UTSW 7 35287227 missense probably damaging 1.00
R0066:Gpatch1 UTSW 7 35287227 missense probably damaging 1.00
R0137:Gpatch1 UTSW 7 35287242 missense probably damaging 1.00
R0347:Gpatch1 UTSW 7 35297631 missense probably benign 0.16
R0382:Gpatch1 UTSW 7 35301655 missense probably damaging 1.00
R0390:Gpatch1 UTSW 7 35281381 intron probably benign
R0791:Gpatch1 UTSW 7 35281376 intron probably benign
R1162:Gpatch1 UTSW 7 35303480 splice site probably benign
R1374:Gpatch1 UTSW 7 35291762 missense probably damaging 1.00
R1480:Gpatch1 UTSW 7 35303338 missense probably damaging 1.00
R1556:Gpatch1 UTSW 7 35295351 missense probably benign 0.00
R1682:Gpatch1 UTSW 7 35303387 missense possibly damaging 0.80
R1887:Gpatch1 UTSW 7 35303388 missense probably damaging 0.98
R1935:Gpatch1 UTSW 7 35295522 missense probably damaging 1.00
R1936:Gpatch1 UTSW 7 35295522 missense probably damaging 1.00
R2148:Gpatch1 UTSW 7 35299276 missense probably benign 0.16
R2205:Gpatch1 UTSW 7 35291772 missense probably damaging 1.00
R2215:Gpatch1 UTSW 7 35293827 missense possibly damaging 0.48
R2274:Gpatch1 UTSW 7 35288678 missense probably benign 0.00
R2275:Gpatch1 UTSW 7 35288678 missense probably benign 0.00
R4126:Gpatch1 UTSW 7 35293654 critical splice donor site probably null
R4705:Gpatch1 UTSW 7 35299305 splice site probably null
R5227:Gpatch1 UTSW 7 35309351 missense probably benign 0.09
R5567:Gpatch1 UTSW 7 35307215 missense probably damaging 0.99
R5810:Gpatch1 UTSW 7 35295371 missense probably benign 0.01
R5946:Gpatch1 UTSW 7 35291832 missense probably damaging 0.99
R6263:Gpatch1 UTSW 7 35303423 missense probably damaging 1.00
R6569:Gpatch1 UTSW 7 35291738 missense probably damaging 1.00
R6847:Gpatch1 UTSW 7 35293558 intron probably null
R7186:Gpatch1 UTSW 7 35295313 missense possibly damaging 0.86
R7259:Gpatch1 UTSW 7 35287121 critical splice donor site probably null
R7276:Gpatch1 UTSW 7 35297496 missense probably benign 0.00
R7516:Gpatch1 UTSW 7 35308200 missense probably benign 0.09
R7521:Gpatch1 UTSW 7 35293788 missense probably damaging 1.00
R7561:Gpatch1 UTSW 7 35309375 missense probably damaging 1.00
R7570:Gpatch1 UTSW 7 35293812 missense probably damaging 1.00
R7588:Gpatch1 UTSW 7 35291748 missense probably damaging 1.00
R7843:Gpatch1 UTSW 7 35281454 missense unknown
R7926:Gpatch1 UTSW 7 35281454 missense unknown
X0020:Gpatch1 UTSW 7 35295381 missense probably benign 0.09
Z1176:Gpatch1 UTSW 7 35310485 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACAGGAGCATAGTATGAACTCTAAG -3'
(R):5'- CCAAACAACTTCATATATGAGTGCC -3'

Sequencing Primer
(F):5'- AGCTCTTCTAAGCCCTAAGGGTAG -3'
(R):5'- ATCCTCTGGAGCTGGAGTGAC -3'
Posted On2018-05-04