Incidental Mutation 'R6386:Vmn2r78'
ID515605
Institutional Source Beutler Lab
Gene Symbol Vmn2r78
Ensembl Gene ENSMUSG00000091962
Gene Namevomeronasal 2, receptor 78
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.074) question?
Stock #R6386 (G1)
Quality Score225.009
Status Not validated
Chromosome7
Chromosomal Location86915300-86955177 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) A to T at 86922337 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Stop codon at position 452 (R452*)
Ref Sequence ENSEMBL: ENSMUSP00000126698 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000170835]
Predicted Effect probably null
Transcript: ENSMUST00000170835
AA Change: R452*
SMART Domains Protein: ENSMUSP00000126698
Gene: ENSMUSG00000091962
AA Change: R452*

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
Pfam:ANF_receptor 75 464 5.9e-31 PFAM
Pfam:NCD3G 507 559 8.1e-21 PFAM
Pfam:7tm_3 592 827 1e-52 PFAM
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.1%
  • 20x: 96.6%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ak6 TGACGA TGA 13: 100,655,803 probably benign Het
Arap2 A T 5: 62,604,522 N1620K possibly damaging Het
Atf6b T C 17: 34,651,851 S396P probably damaging Het
Cc2d1a A G 8: 84,138,537 M469T probably damaging Het
Ceacam3 A G 7: 17,158,219 N296D probably benign Het
Cep57l1 A T 10: 41,743,132 S80T probably damaging Het
Clip4 C A 17: 71,834,194 Y514* probably null Het
Cop1 T C 1: 159,289,031 I125T probably damaging Het
Cstf1 T C 2: 172,377,896 V309A probably damaging Het
Cyp4a29 T G 4: 115,247,075 probably null Het
F830045P16Rik G A 2: 129,472,818 H180Y probably damaging Het
Foxp4 T C 17: 47,878,462 K237E unknown Het
Fstl5 A T 3: 76,322,066 H58L probably benign Het
Gje1 A G 10: 14,716,621 F139S probably damaging Het
Gpatch1 T C 7: 35,291,840 D593G probably damaging Het
Inpp5d T A 1: 87,699,675 L566Q probably damaging Het
Mtch2 A G 2: 90,849,395 T38A probably benign Het
Mvb12b A T 2: 33,827,742 I129N probably damaging Het
Npffr2 T C 5: 89,582,697 V162A probably benign Het
Olfr1424 A T 19: 12,059,556 N65K probably damaging Het
Olfr485 A T 7: 108,159,202 Y224N probably damaging Het
Pkhd1 G A 1: 20,551,020 R805C probably damaging Het
Ppp4r4 T C 12: 103,593,105 L406P probably damaging Het
Prl3d2 A G 13: 27,127,303 D186G probably damaging Het
Rfc5 T C 5: 117,385,398 T112A probably benign Het
Rnf148 A G 6: 23,654,484 L171P probably damaging Het
Rps24 G A 14: 24,492,048 G71S possibly damaging Het
Slco2a1 G A 9: 103,076,988 V453I probably benign Het
Spidr T C 16: 15,968,560 K440E probably benign Het
Syndig1 C A 2: 149,899,576 N27K probably damaging Het
Tmem62 C T 2: 120,999,114 T316I probably benign Het
Tpgs2 A T 18: 25,139,024 I258N possibly damaging Het
Wasf3 A T 5: 146,453,417 I124F possibly damaging Het
Wbp11 T C 6: 136,820,525 T299A probably benign Het
Wdr25 T C 12: 109,025,065 S41P probably damaging Het
Zfp874b T C 13: 67,474,843 D116G possibly damaging Het
Other mutations in Vmn2r78
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01302:Vmn2r78 APN 7 86915361 missense unknown
IGL01473:Vmn2r78 APN 7 86920312 missense possibly damaging 0.61
IGL01767:Vmn2r78 APN 7 86954435 missense probably benign 0.28
IGL02322:Vmn2r78 APN 7 86921479 missense probably damaging 0.96
IGL02537:Vmn2r78 APN 7 86954288 missense probably damaging 0.99
IGL03297:Vmn2r78 APN 7 86920761 nonsense probably null
ANU74:Vmn2r78 UTSW 7 86921065 missense possibly damaging 0.62
R0035:Vmn2r78 UTSW 7 86920205 missense probably benign 0.22
R0081:Vmn2r78 UTSW 7 86923027 missense probably benign 0.35
R0401:Vmn2r78 UTSW 7 86921311 missense probably benign 0.04
R0751:Vmn2r78 UTSW 7 86954380 missense possibly damaging 0.77
R1341:Vmn2r78 UTSW 7 86922269 missense possibly damaging 0.71
R1386:Vmn2r78 UTSW 7 86915407 missense unknown
R1526:Vmn2r78 UTSW 7 86922257 splice site probably null
R1712:Vmn2r78 UTSW 7 86954924 missense probably damaging 1.00
R1739:Vmn2r78 UTSW 7 86920789 missense probably benign
R1812:Vmn2r78 UTSW 7 86920787 missense probably benign 0.38
R2011:Vmn2r78 UTSW 7 86955079 missense possibly damaging 0.52
R2144:Vmn2r78 UTSW 7 86954482 missense probably damaging 1.00
R2197:Vmn2r78 UTSW 7 86921327 missense probably damaging 0.96
R2291:Vmn2r78 UTSW 7 86920154 missense probably damaging 1.00
R2409:Vmn2r78 UTSW 7 86920745 splice site probably benign
R3023:Vmn2r78 UTSW 7 86954966 missense probably damaging 1.00
R4486:Vmn2r78 UTSW 7 86920751 critical splice acceptor site probably null
R4512:Vmn2r78 UTSW 7 86920244 missense probably benign 0.00
R4515:Vmn2r78 UTSW 7 86954258 missense probably damaging 0.99
R4544:Vmn2r78 UTSW 7 86921191 missense probably benign
R4546:Vmn2r78 UTSW 7 86954603 missense probably damaging 1.00
R4872:Vmn2r78 UTSW 7 86954708 missense possibly damaging 0.87
R4928:Vmn2r78 UTSW 7 86954627 missense probably damaging 1.00
R5101:Vmn2r78 UTSW 7 86922355 missense probably damaging 1.00
R5265:Vmn2r78 UTSW 7 86920124 missense probably damaging 1.00
R5328:Vmn2r78 UTSW 7 86921030 missense probably damaging 0.98
R5442:Vmn2r78 UTSW 7 86920122 missense possibly damaging 0.95
R5567:Vmn2r78 UTSW 7 86921529 missense probably benign 0.17
R5572:Vmn2r78 UTSW 7 86915512 missense probably benign 0.01
R5636:Vmn2r78 UTSW 7 86954429 missense probably damaging 0.99
R5901:Vmn2r78 UTSW 7 86954588 missense probably damaging 1.00
R5977:Vmn2r78 UTSW 7 86920333 missense possibly damaging 0.74
R5977:Vmn2r78 UTSW 7 86954907 missense probably benign 0.00
R6276:Vmn2r78 UTSW 7 86921110 missense probably benign 0.00
R6724:Vmn2r78 UTSW 7 86954258 missense probably damaging 0.99
R6852:Vmn2r78 UTSW 7 86954603 missense probably damaging 1.00
R6896:Vmn2r78 UTSW 7 86922350 missense probably benign 0.10
R7385:Vmn2r78 UTSW 7 86922425 missense probably benign 0.18
R7578:Vmn2r78 UTSW 7 86954344 nonsense probably null
R7680:Vmn2r78 UTSW 7 86954941 missense probably damaging 1.00
R7748:Vmn2r78 UTSW 7 86921135 missense probably benign 0.00
R7852:Vmn2r78 UTSW 7 86920170 nonsense probably null
R7935:Vmn2r78 UTSW 7 86920170 nonsense probably null
R8031:Vmn2r78 UTSW 7 86954867 missense probably damaging 1.00
R8070:Vmn2r78 UTSW 7 86922487 missense probably benign 0.01
RF018:Vmn2r78 UTSW 7 86954431 nonsense probably null
Z1177:Vmn2r78 UTSW 7 86921207 missense probably benign 0.44
Z1177:Vmn2r78 UTSW 7 86954774 missense probably benign 0.02
Predicted Primers PCR Primer
(F):5'- CGTGTGCGAACGTATCAGAA -3'
(R):5'- ACATGAGTGAGTGAATGAGTGATT -3'

Sequencing Primer
(F):5'- TGTGCGAACGTATCAGAAAATACTG -3'
(R):5'- TGATTAGGAGAGAGATCAAATAGCTG -3'
Posted On2018-05-04