Mutagenetix > Incidental Mutations

Incidental Mutation 'R6386:Vmn2r78'

515605

Institutional Source

Beutler Lab

Gene Symbol

Vmn2r78

Ensembl Gene

ENSMUSG00000091962

Gene Name

vomeronasal 2, receptor 78

Synonyms

MMRRC Submission

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.060) question?

Stock #

R6386 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

86915300-86955177 bp(+) (GRCm38)

Type of Mutation

nonsense

DNA Base Change (assembly)

A to T at 86922337 bp

Zygosity

Heterozygous

Amino Acid Change

Arginine to Stop codon at position 452 (R452*)

Ref Sequence

ENSEMBL: ENSMUSP00000126698 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000170835]

Predicted Effect

probably null
Transcript: ENSMUST00000170835
AA Change: R452*

SMART Domains

Protein: ENSMUSP00000126698
Gene: ENSMUSG00000091962
AA Change: R452*

Domain	Start	End	E-Value	Type
signal peptide	1	21	N/A	INTRINSIC
Pfam:ANF_receptor	75	464	5.9e-31	PFAM
Pfam:NCD3G	507	559	8.1e-21	PFAM
Pfam:7tm_3	592	827	1e-52	PFAM

Meta Mutation Damage Score

0.9755

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.1%
20x: 96.6%

Validation Efficiency

Allele List at MGI

Other mutations in this stock

Total: 36 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Ak6	TGACGA	TGA	13: 100,655,803		probably benign	Het
Arap2	A	T	5: 62,604,522	N1620K	possibly damaging	Het
Atf6b	T	C	17: 34,651,851	S396P	probably damaging	Het
Cc2d1a	A	G	8: 84,138,537	M469T	probably damaging	Het
Ceacam3	A	G	7: 17,158,219	N296D	probably benign	Het
Cep57l1	A	T	10: 41,743,132	S80T	probably damaging	Het
Clip4	C	A	17: 71,834,194	Y514*	probably null	Het
Cop1	T	C	1: 159,289,031	I125T	probably damaging	Het
Cstf1	T	C	2: 172,377,896	V309A	probably damaging	Het
Cyp4a29	T	G	4: 115,247,075		probably null	Het
F830045P16Rik	G	A	2: 129,472,818	H180Y	probably damaging	Het
Foxp4	T	C	17: 47,878,462	K237E	unknown	Het
Fstl5	A	T	3: 76,322,066	H58L	probably benign	Het
Gje1	A	G	10: 14,716,621	F139S	probably damaging	Het
Gpatch1	T	C	7: 35,291,840	D593G	probably damaging	Het
Inpp5d	T	A	1: 87,699,675	L566Q	probably damaging	Het
Mtch2	A	G	2: 90,849,395	T38A	probably benign	Het
Mvb12b	A	T	2: 33,827,742	I129N	probably damaging	Het
Npffr2	T	C	5: 89,582,697	V162A	probably benign	Het
Olfr1424	A	T	19: 12,059,556	N65K	probably damaging	Het
Olfr485	A	T	7: 108,159,202	Y224N	probably damaging	Het
Pkhd1	G	A	1: 20,551,020	R805C	probably damaging	Het
Ppp4r4	T	C	12: 103,593,105	L406P	probably damaging	Het
Prl3d2	A	G	13: 27,127,303	D186G	probably damaging	Het
Rfc5	T	C	5: 117,385,398	T112A	probably benign	Het
Rnf148	A	G	6: 23,654,484	L171P	probably damaging	Het
Rps24	G	A	14: 24,492,048	G71S	possibly damaging	Het
Slco2a1	G	A	9: 103,076,988	V453I	probably benign	Het
Spidr	T	C	16: 15,968,560	K440E	probably benign	Het
Syndig1	C	A	2: 149,899,576	N27K	probably damaging	Het
Tmem62	C	T	2: 120,999,114	T316I	probably benign	Het
Tpgs2	A	T	18: 25,139,024	I258N	possibly damaging	Het
Wasf3	A	T	5: 146,453,417	I124F	possibly damaging	Het
Wbp11	T	C	6: 136,820,525	T299A	probably benign	Het
Wdr25	T	C	12: 109,025,065	S41P	probably damaging	Het
Zfp874b	T	C	13: 67,474,843	D116G	possibly damaging	Het

Other mutations in Vmn2r78

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01302:Vmn2r78	APN	7	86915361	missense	unknown
IGL01473:Vmn2r78	APN	7	86920312	missense	possibly damaging	0.61
IGL01767:Vmn2r78	APN	7	86954435	missense	probably benign	0.28
IGL02322:Vmn2r78	APN	7	86921479	missense	probably damaging	0.96
IGL02537:Vmn2r78	APN	7	86954288	missense	probably damaging	0.99
IGL03297:Vmn2r78	APN	7	86920761	nonsense	probably null
ANU74:Vmn2r78	UTSW	7	86921065	missense	possibly damaging	0.62
R0035:Vmn2r78	UTSW	7	86920205	missense	probably benign	0.22
R0081:Vmn2r78	UTSW	7	86923027	missense	probably benign	0.35
R0401:Vmn2r78	UTSW	7	86921311	missense	probably benign	0.04
R0751:Vmn2r78	UTSW	7	86954380	missense	possibly damaging	0.77
R1341:Vmn2r78	UTSW	7	86922269	missense	possibly damaging	0.71
R1386:Vmn2r78	UTSW	7	86915407	missense	unknown
R1526:Vmn2r78	UTSW	7	86922257	splice site	probably null
R1712:Vmn2r78	UTSW	7	86954924	missense	probably damaging	1.00
R1739:Vmn2r78	UTSW	7	86920789	missense	probably benign
R1812:Vmn2r78	UTSW	7	86920787	missense	probably benign	0.38
R2011:Vmn2r78	UTSW	7	86955079	missense	possibly damaging	0.52
R2144:Vmn2r78	UTSW	7	86954482	missense	probably damaging	1.00
R2197:Vmn2r78	UTSW	7	86921327	missense	probably damaging	0.96
R2291:Vmn2r78	UTSW	7	86920154	missense	probably damaging	1.00
R2409:Vmn2r78	UTSW	7	86920745	splice site	probably benign
R3023:Vmn2r78	UTSW	7	86954966	missense	probably damaging	1.00
R4486:Vmn2r78	UTSW	7	86920751	critical splice acceptor site	probably null
R4512:Vmn2r78	UTSW	7	86920244	missense	probably benign	0.00
R4515:Vmn2r78	UTSW	7	86954258	missense	probably damaging	0.99
R4544:Vmn2r78	UTSW	7	86921191	missense	probably benign
R4546:Vmn2r78	UTSW	7	86954603	missense	probably damaging	1.00
R4872:Vmn2r78	UTSW	7	86954708	missense	possibly damaging	0.87
R4928:Vmn2r78	UTSW	7	86954627	missense	probably damaging	1.00
R5101:Vmn2r78	UTSW	7	86922355	missense	probably damaging	1.00
R5265:Vmn2r78	UTSW	7	86920124	missense	probably damaging	1.00
R5328:Vmn2r78	UTSW	7	86921030	missense	probably damaging	0.98
R5442:Vmn2r78	UTSW	7	86920122	missense	possibly damaging	0.95
R5567:Vmn2r78	UTSW	7	86921529	missense	probably benign	0.17
R5572:Vmn2r78	UTSW	7	86915512	missense	probably benign	0.01
R5636:Vmn2r78	UTSW	7	86954429	missense	probably damaging	0.99
R5901:Vmn2r78	UTSW	7	86954588	missense	probably damaging	1.00
R5977:Vmn2r78	UTSW	7	86920333	missense	possibly damaging	0.74
R5977:Vmn2r78	UTSW	7	86954907	missense	probably benign	0.00
R6276:Vmn2r78	UTSW	7	86921110	missense	probably benign	0.00
R6724:Vmn2r78	UTSW	7	86954258	missense	probably damaging	0.99
R6852:Vmn2r78	UTSW	7	86954603	missense	probably damaging	1.00
R6896:Vmn2r78	UTSW	7	86922350	missense	probably benign	0.10
R7385:Vmn2r78	UTSW	7	86922425	missense	probably benign	0.18
R7578:Vmn2r78	UTSW	7	86954344	nonsense	probably null
R7680:Vmn2r78	UTSW	7	86954941	missense	probably damaging	1.00
R7748:Vmn2r78	UTSW	7	86921135	missense	probably benign	0.00
R7852:Vmn2r78	UTSW	7	86920170	nonsense	probably null
R8031:Vmn2r78	UTSW	7	86954867	missense	probably damaging	1.00
R8070:Vmn2r78	UTSW	7	86922487	missense	probably benign	0.01
R8085:Vmn2r78	UTSW	7	86954790	missense	probably benign	0.00
R8163:Vmn2r78	UTSW	7	86954452	missense	probably damaging	1.00
R8501:Vmn2r78	UTSW	7	86920886	missense	probably damaging	0.99
R8749:Vmn2r78	UTSW	7	86954305	missense	possibly damaging	0.81
RF018:Vmn2r78	UTSW	7	86954431	nonsense	probably null
Z1177:Vmn2r78	UTSW	7	86921207	missense	probably benign	0.44
Z1177:Vmn2r78	UTSW	7	86954774	missense	probably benign	0.02

Predicted Primers

PCR Primer
(F):5'- CGTGTGCGAACGTATCAGAA -3'
(R):5'- ACATGAGTGAGTGAATGAGTGATT -3'

Sequencing Primer
(F):5'- TGTGCGAACGTATCAGAAAATACTG -3'
(R):5'- TGATTAGGAGAGAGATCAAATAGCTG -3'

Posted On

2018-05-04