Incidental Mutation 'R6386:Cc2d1a'
ID515607
Institutional Source Beutler Lab
Gene Symbol Cc2d1a
Ensembl Gene ENSMUSG00000036686
Gene Namecoiled-coil and C2 domain containing 1A
SynonymsFreud-1, Tape
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.811) question?
Stock #R6386 (G1)
Quality Score225.009
Status Not validated
Chromosome8
Chromosomal Location84132828-84147936 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 84138537 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Threonine at position 469 (M469T)
Ref Sequence ENSEMBL: ENSMUSP00000112556 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000040383] [ENSMUST00000117424]
Predicted Effect probably benign
Transcript: ENSMUST00000040383
AA Change: M515T

PolyPhen 2 Score 0.046 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000046449
Gene: ENSMUSG00000036686
AA Change: M515T

DomainStartEndE-ValueType
low complexity region 41 51 N/A INTRINSIC
low complexity region 83 110 N/A INTRINSIC
DM14 137 194 1.02e-14 SMART
low complexity region 195 206 N/A INTRINSIC
low complexity region 229 238 N/A INTRINSIC
DM14 250 308 8.7e-23 SMART
DM14 342 400 7.44e-31 SMART
low complexity region 457 478 N/A INTRINSIC
DM14 487 545 4.62e-27 SMART
C2 649 763 5.08e-8 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000117424
AA Change: M469T

PolyPhen 2 Score 0.957 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000112556
Gene: ENSMUSG00000036686
AA Change: M469T

DomainStartEndE-ValueType
low complexity region 41 51 N/A INTRINSIC
low complexity region 83 110 N/A INTRINSIC
low complexity region 150 161 N/A INTRINSIC
low complexity region 184 193 N/A INTRINSIC
DM14 205 263 8.7e-23 SMART
DM14 297 355 7.44e-31 SMART
low complexity region 411 432 N/A INTRINSIC
DM14 441 499 4.62e-27 SMART
C2 603 717 5.08e-8 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000154029
Meta Mutation Damage Score 0.0794 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.1%
  • 20x: 96.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a transcriptional repressor that binds to a conserved 14-bp 5'-repressor element and regulates expression of the 5-hydroxytryptamine (serotonin) receptor 1A gene in neuronal cells. The DNA binding and transcriptional repressor activities of the protein are inhibited by calcium. A mutation in this gene results in nonsyndromic mental retardation-3.[provided by RefSeq, Oct 2009]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit partial neonatal lethality, reduced body weight, hunched posture, respiratory distress, increased sensitivity of neurons to hydrogen peroxide, reduced dendrite length, abnormal brain vasculature and reduced synaptic number and density. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ak6 TGACGA TGA 13: 100,655,803 probably benign Het
Arap2 A T 5: 62,604,522 N1620K possibly damaging Het
Atf6b T C 17: 34,651,851 S396P probably damaging Het
Ceacam3 A G 7: 17,158,219 N296D probably benign Het
Cep57l1 A T 10: 41,743,132 S80T probably damaging Het
Clip4 C A 17: 71,834,194 Y514* probably null Het
Cop1 T C 1: 159,289,031 I125T probably damaging Het
Cstf1 T C 2: 172,377,896 V309A probably damaging Het
Cyp4a29 T G 4: 115,247,075 probably null Het
F830045P16Rik G A 2: 129,472,818 H180Y probably damaging Het
Foxp4 T C 17: 47,878,462 K237E unknown Het
Fstl5 A T 3: 76,322,066 H58L probably benign Het
Gje1 A G 10: 14,716,621 F139S probably damaging Het
Gpatch1 T C 7: 35,291,840 D593G probably damaging Het
Inpp5d T A 1: 87,699,675 L566Q probably damaging Het
Mtch2 A G 2: 90,849,395 T38A probably benign Het
Mvb12b A T 2: 33,827,742 I129N probably damaging Het
Npffr2 T C 5: 89,582,697 V162A probably benign Het
Olfr1424 A T 19: 12,059,556 N65K probably damaging Het
Olfr485 A T 7: 108,159,202 Y224N probably damaging Het
Pkhd1 G A 1: 20,551,020 R805C probably damaging Het
Ppp4r4 T C 12: 103,593,105 L406P probably damaging Het
Prl3d2 A G 13: 27,127,303 D186G probably damaging Het
Rfc5 T C 5: 117,385,398 T112A probably benign Het
Rnf148 A G 6: 23,654,484 L171P probably damaging Het
Rps24 G A 14: 24,492,048 G71S possibly damaging Het
Slco2a1 G A 9: 103,076,988 V453I probably benign Het
Spidr T C 16: 15,968,560 K440E probably benign Het
Syndig1 C A 2: 149,899,576 N27K probably damaging Het
Tmem62 C T 2: 120,999,114 T316I probably benign Het
Tpgs2 A T 18: 25,139,024 I258N possibly damaging Het
Vmn2r78 A T 7: 86,922,337 R452* probably null Het
Wasf3 A T 5: 146,453,417 I124F possibly damaging Het
Wbp11 T C 6: 136,820,525 T299A probably benign Het
Wdr25 T C 12: 109,025,065 S41P probably damaging Het
Zfp874b T C 13: 67,474,843 D116G possibly damaging Het
Other mutations in Cc2d1a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01078:Cc2d1a APN 8 84140265 missense possibly damaging 0.87
IGL01126:Cc2d1a APN 8 84143404 missense probably benign 0.11
IGL01129:Cc2d1a APN 8 84143404 missense probably benign 0.11
IGL01133:Cc2d1a APN 8 84143404 missense probably benign 0.11
IGL01135:Cc2d1a APN 8 84143404 missense probably benign 0.11
IGL01953:Cc2d1a APN 8 84143978 missense probably benign 0.00
IGL02216:Cc2d1a APN 8 84139313 nonsense probably null
IGL03131:Cc2d1a APN 8 84143427 missense probably damaging 1.00
IGL03268:Cc2d1a APN 8 84133525 missense probably damaging 1.00
IGL03401:Cc2d1a APN 8 84134629 missense probably benign 0.00
R0313:Cc2d1a UTSW 8 84136969 missense probably benign 0.38
R0811:Cc2d1a UTSW 8 84133836 missense probably benign 0.23
R0812:Cc2d1a UTSW 8 84133836 missense probably benign 0.23
R0893:Cc2d1a UTSW 8 84140839 splice site probably benign
R1440:Cc2d1a UTSW 8 84133975 critical splice donor site probably null
R1625:Cc2d1a UTSW 8 84139372 missense probably damaging 1.00
R2183:Cc2d1a UTSW 8 84140399 missense probably damaging 1.00
R5155:Cc2d1a UTSW 8 84141126 missense probably benign 0.00
R5959:Cc2d1a UTSW 8 84133503 nonsense probably null
R6046:Cc2d1a UTSW 8 84136942 missense possibly damaging 0.81
R6956:Cc2d1a UTSW 8 84135899 missense probably damaging 1.00
R6992:Cc2d1a UTSW 8 84134913 missense probably damaging 1.00
R7156:Cc2d1a UTSW 8 84135760 missense possibly damaging 0.69
R7456:Cc2d1a UTSW 8 84140239 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- AACGGCCTACTTGTCGAGAG -3'
(R):5'- TACGCAGCAGAATACCCCTG -3'

Sequencing Primer
(F):5'- GGGCAGCTTAGCTTAAATGATAC -3'
(R):5'- ACCCAGCTGAAGTCCTCG -3'
Posted On2018-05-04