Incidental Mutation 'R6386:Ppp4r4'
ID515611
Institutional Source Beutler Lab
Gene Symbol Ppp4r4
Ensembl Gene ENSMUSG00000021209
Gene Nameprotein phosphatase 4, regulatory subunit 4
Synonyms8430415E04Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.182) question?
Stock #R6386 (G1)
Quality Score225.009
Status Not validated
Chromosome12
Chromosomal Location103532283-103613831 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 103593105 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Proline at position 406 (L406P)
Ref Sequence ENSEMBL: ENSMUSP00000140874 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021631] [ENSMUST00000187155] [ENSMUST00000189871] [ENSMUST00000190664]
Predicted Effect probably damaging
Transcript: ENSMUST00000021631
AA Change: L515P

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000021631
Gene: ENSMUSG00000021209
AA Change: L515P

DomainStartEndE-ValueType
SCOP:d1gw5a_ 55 577 6e-27 SMART
PDB:3FGA|A 178 666 8e-6 PDB
coiled coil region 690 726 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000187155
AA Change: L406P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000140874
Gene: ENSMUSG00000021209
AA Change: L406P

DomainStartEndE-ValueType
Pfam:HEAT 145 175 2.8e-3 PFAM
low complexity region 484 495 N/A INTRINSIC
coiled coil region 581 617 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000189871
AA Change: L515P

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000139786
Gene: ENSMUSG00000021209
AA Change: L515P

DomainStartEndE-ValueType
SCOP:d1gw5a_ 95 577 7e-26 SMART
PDB:1B3U|B 178 666 2e-6 PDB
coiled coil region 690 726 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000190664
SMART Domains Protein: ENSMUSP00000140295
Gene: ENSMUSG00000021209

DomainStartEndE-ValueType
Pfam:HEAT 38 68 5.8e-4 PFAM
Meta Mutation Damage Score 0.8387 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.1%
  • 20x: 96.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a HEAT-like repeat-containing protein. The HEAT repeat is a tandemly repeated, 37-47 amino acid long module occurring in a number of cytoplasmic proteins. Arrays of HEAT repeats form a rod-like helical structure and appear to function as protein-protein interaction surfaces. The repeat-containing region of this protein has some similarity to the constant regulatory domain of the protein phosphatase 2A PR65/A subunit. The encoded protein binds protein serine/threonine phosphatase 4c in the cytoplasm. [provided by RefSeq, Jan 2017]
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ak6 TGACGA TGA 13: 100,655,803 probably benign Het
Arap2 A T 5: 62,604,522 N1620K possibly damaging Het
Atf6b T C 17: 34,651,851 S396P probably damaging Het
Cc2d1a A G 8: 84,138,537 M469T probably damaging Het
Ceacam3 A G 7: 17,158,219 N296D probably benign Het
Cep57l1 A T 10: 41,743,132 S80T probably damaging Het
Clip4 C A 17: 71,834,194 Y514* probably null Het
Cop1 T C 1: 159,289,031 I125T probably damaging Het
Cstf1 T C 2: 172,377,896 V309A probably damaging Het
Cyp4a29 T G 4: 115,247,075 probably null Het
F830045P16Rik G A 2: 129,472,818 H180Y probably damaging Het
Foxp4 T C 17: 47,878,462 K237E unknown Het
Fstl5 A T 3: 76,322,066 H58L probably benign Het
Gje1 A G 10: 14,716,621 F139S probably damaging Het
Gpatch1 T C 7: 35,291,840 D593G probably damaging Het
Inpp5d T A 1: 87,699,675 L566Q probably damaging Het
Mtch2 A G 2: 90,849,395 T38A probably benign Het
Mvb12b A T 2: 33,827,742 I129N probably damaging Het
Npffr2 T C 5: 89,582,697 V162A probably benign Het
Olfr1424 A T 19: 12,059,556 N65K probably damaging Het
Olfr485 A T 7: 108,159,202 Y224N probably damaging Het
Pkhd1 G A 1: 20,551,020 R805C probably damaging Het
Prl3d2 A G 13: 27,127,303 D186G probably damaging Het
Rfc5 T C 5: 117,385,398 T112A probably benign Het
Rnf148 A G 6: 23,654,484 L171P probably damaging Het
Rps24 G A 14: 24,492,048 G71S possibly damaging Het
Slco2a1 G A 9: 103,076,988 V453I probably benign Het
Spidr T C 16: 15,968,560 K440E probably benign Het
Syndig1 C A 2: 149,899,576 N27K probably damaging Het
Tmem62 C T 2: 120,999,114 T316I probably benign Het
Tpgs2 A T 18: 25,139,024 I258N possibly damaging Het
Vmn2r78 A T 7: 86,922,337 R452* probably null Het
Wasf3 A T 5: 146,453,417 I124F possibly damaging Het
Wbp11 T C 6: 136,820,525 T299A probably benign Het
Wdr25 T C 12: 109,025,065 S41P probably damaging Het
Zfp874b T C 13: 67,474,843 D116G possibly damaging Het
Other mutations in Ppp4r4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00827:Ppp4r4 APN 12 103579076 missense probably benign
IGL01388:Ppp4r4 APN 12 103576849 missense probably damaging 1.00
IGL01662:Ppp4r4 APN 12 103602966 missense possibly damaging 0.55
IGL01768:Ppp4r4 APN 12 103581405 missense probably benign 0.12
IGL01894:Ppp4r4 APN 12 103593138 missense probably damaging 1.00
IGL01921:Ppp4r4 APN 12 103576310 start codon destroyed probably null 0.01
IGL01960:Ppp4r4 APN 12 103581494 splice site probably benign
IGL02084:Ppp4r4 APN 12 103600398 missense possibly damaging 0.93
IGL02287:Ppp4r4 APN 12 103587488 missense probably benign 0.01
IGL02315:Ppp4r4 APN 12 103600361 splice site probably benign
IGL03137:Ppp4r4 APN 12 103581384 missense probably damaging 1.00
IGL03170:Ppp4r4 APN 12 103590774 intron probably benign
cataract UTSW 12 103612815 nonsense probably null
downfall UTSW 12 103593098 missense probably benign 0.00
R0114:Ppp4r4 UTSW 12 103576374 missense probably benign 0.00
R0390:Ppp4r4 UTSW 12 103601360 splice site probably benign
R0403:Ppp4r4 UTSW 12 103584102 missense probably benign
R0548:Ppp4r4 UTSW 12 103612815 nonsense probably null
R0601:Ppp4r4 UTSW 12 103600520 splice site probably benign
R0894:Ppp4r4 UTSW 12 103600495 missense probably damaging 0.99
R1127:Ppp4r4 UTSW 12 103579068 missense probably damaging 1.00
R1177:Ppp4r4 UTSW 12 103576323 missense possibly damaging 0.82
R1378:Ppp4r4 UTSW 12 103581492 splice site probably benign
R1442:Ppp4r4 UTSW 12 103598245 missense probably damaging 0.97
R1497:Ppp4r4 UTSW 12 103606945 missense probably benign 0.07
R1651:Ppp4r4 UTSW 12 103584072 missense probably benign 0.01
R1797:Ppp4r4 UTSW 12 103598151 missense possibly damaging 0.95
R1880:Ppp4r4 UTSW 12 103605035 missense possibly damaging 0.62
R2008:Ppp4r4 UTSW 12 103585757 missense probably damaging 1.00
R2038:Ppp4r4 UTSW 12 103576280 critical splice acceptor site probably null
R2404:Ppp4r4 UTSW 12 103581490 splice site probably null
R2696:Ppp4r4 UTSW 12 103581394 missense possibly damaging 0.77
R2849:Ppp4r4 UTSW 12 103606933 missense probably benign 0.00
R2965:Ppp4r4 UTSW 12 103612821 missense probably damaging 1.00
R3030:Ppp4r4 UTSW 12 103606956 missense probably benign
R3805:Ppp4r4 UTSW 12 103600366 missense probably damaging 0.99
R3862:Ppp4r4 UTSW 12 103596421 nonsense probably null
R4194:Ppp4r4 UTSW 12 103558445 missense probably damaging 1.00
R4320:Ppp4r4 UTSW 12 103598243 missense probably damaging 1.00
R4558:Ppp4r4 UTSW 12 103606933 missense probably benign 0.00
R4783:Ppp4r4 UTSW 12 103590858 critical splice donor site probably null
R4866:Ppp4r4 UTSW 12 103600447 missense possibly damaging 0.92
R4903:Ppp4r4 UTSW 12 103590771 splice site probably null
R5309:Ppp4r4 UTSW 12 103606888 splice site probably null
R5312:Ppp4r4 UTSW 12 103606888 splice site probably null
R5381:Ppp4r4 UTSW 12 103593098 missense probably benign 0.00
R5383:Ppp4r4 UTSW 12 103584168 missense probably benign 0.14
R5447:Ppp4r4 UTSW 12 103584151 missense possibly damaging 0.67
R5942:Ppp4r4 UTSW 12 103587447 missense possibly damaging 0.92
R6339:Ppp4r4 UTSW 12 103604969 nonsense probably null
R6712:Ppp4r4 UTSW 12 103596443 missense probably damaging 1.00
R6755:Ppp4r4 UTSW 12 103585737 missense probably damaging 1.00
R6868:Ppp4r4 UTSW 12 103590852 missense probably damaging 1.00
R6879:Ppp4r4 UTSW 12 103551920 intron probably null
R7355:Ppp4r4 UTSW 12 103604582 nonsense probably null
R7397:Ppp4r4 UTSW 12 103612806 critical splice acceptor site probably null
R7447:Ppp4r4 UTSW 12 103585726 missense possibly damaging 0.46
R7576:Ppp4r4 UTSW 12 103596449 missense probably damaging 0.97
R7653:Ppp4r4 UTSW 12 103584145 missense probably damaging 0.98
R7683:Ppp4r4 UTSW 12 103587105 nonsense probably null
R7748:Ppp4r4 UTSW 12 103605061 critical splice donor site probably null
R7831:Ppp4r4 UTSW 12 103590821 missense possibly damaging 0.76
R7833:Ppp4r4 UTSW 12 103598148 missense probably benign 0.03
R7914:Ppp4r4 UTSW 12 103590821 missense possibly damaging 0.76
R7916:Ppp4r4 UTSW 12 103598148 missense probably benign 0.03
X0025:Ppp4r4 UTSW 12 103600480 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AAAGTCCTTCCCTGGTGTCTG -3'
(R):5'- CTGGGGAAATGTTACCCTTCC -3'

Sequencing Primer
(F):5'- TACTCCAGGCTGCAGTTGATG -3'
(R):5'- TGTTACCCTTCCAAGCTAATAGG -3'
Posted On2018-05-04